Back to skills
extension
Category: Data & AnalyticsNo API key required

读取质量控制 / Sequencing data QC

>-

personAuthor: user_f4fc8899hubcommunity

read-qc 分类 Skill 整合版

本文件整合同一主分类目录下 7 个子目录中的 SKILL.md 内容。 各子目录正文按原文保留,并通过标题和边界标记进行区分;源文件中的元数据块未被改写。


<!-- BEGIN CATEGORY: read-qc -->

子目录:read-qc/adapter-trimming

<!-- BEGIN FILE: read-qc/adapter-trimming/SKILL.md -->

name: bio-read-qc-adapter-trimming description: Removes sequencing adapters from FASTQ reads with Cutadapt and Trimmomatic, including paired-end read-through, small-RNA 3' adapters, amplicon primers, and anchored/linked adapters. Use when FastQC shows adapter content climbing toward the 3' end, when inserts are shorter than the read length (small-RNA, cfDNA, FFPE), or before assembly/k-mer analysis. For all-in-one trimming use fastp-workflow; for quality/length filtering use quality-filtering. tool_type: cli primary_tool: cutadapt

Version Compatibility

Reference examples tested with: Cutadapt 4.4+, Trimmomatic 0.39+, fastp 0.23+, FastQC 0.12+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Adapter Trimming -- adapter content IS the insert-size distribution

Remove adapter sequence that the polymerase read INTO once it ran off the end of a short insert, using Cutadapt (precise, the correctness reference) or Trimmomatic (palindrome mode for paired read-through).

"Trim adapters from my reads" -> Detect and remove 3' adapter introduced by read-through, then length-filter the survivors.

  • CLI: cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20 -o R1.fq -p R2.fq in_R1.fq in_R2.fq
  • All-in-one alternative: fastp (PE overlap analysis needs no adapter sequence) -> read-qc/fastp-workflow

Scope: this skill OWNS adapter/primer removal. Quality and length filtering -> read-qc/quality-filtering. Single-pass trim+QC -> read-qc/fastp-workflow. Contaminant/PhiX k-mer removal -> read-qc/contamination-screening. OUT OF SCOPE: quality-score trimming as a standalone goal (usually unnecessary before soft-clipping aligners; see insight 2).

The Single Most Important Modern Insight

  1. Adapter appears only when the insert is shorter than the read, so adapter content is a direct readout of the insert-size distribution -- and adapter trimming is 3'-only for standard Illumina. The library is [P5]-[insert]-[P7]; a read primes at the insert boundary and reads 5'->3' into the insert, running into the 3'/P7-side adapter only if it runs out of insert. Short-insert libraries (small-RNA ~22 nt, cfDNA ~167 bp, FFPE, degraded RNA, ancient DNA) are read-through-dominated; long-insert WGS may show almost none. The FastQC adapter-content curve climbing toward the 3' end IS that insert-size signal.

  2. Adapter trimming is the one near-universal preprocessing step; quality trimming usually is not. Local aligners (BWA-MEM, STAR, Bowtie2 local, HISAT2) SOFT-CLIP low-quality tails, so quality trimming is redundant or harmful for alignment-based DNA/RNA (MacManes 2014, Williams 2016; GATK discourages it before BQSR). But aligners do NOT reliably remove ADAPTER -- adapter is foreign sequence with genuine base quality, so the aligner may try to align it and anchor a wrong placement. Trim adapter; leave quality trimming to the cases that need it (assembly, k-mer/pseudo-alignment, small-RNA, amplicon, no-BQSR variant calling).

  3. Small-RNA inverts the logic: the adapter is on EVERY read, so DISCARD reads with no adapter. A ~22 nt miRNA insert is far shorter than a 50-75 nt read, so read-through is universal; a read with no detectable adapter is an adapter dimer, a too-long contaminant, or junk. Use --discard-untrimmed plus a tight length gate (-m 18 -M 30). This is the OPPOSITE of genomic DNA, where the no-adapter reads are the good full-length inserts.

Two-color trap: on NextSeq/NovaSeq, a high-quality poly-G tail is NOT adapter and is not removed by adapter trimming -- it needs a chemistry-aware poly-G trim (cutadapt --nextseq-trim=20, or fastp's auto poly-G). See read-qc/quality-reports and read-qc/fastp-workflow.

Verified Adapter Sequences

| Kit | Read | Sequence | |-----|------|----------| | Illumina TruSeq | R1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | | Illumina TruSeq | R2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | | TruSeq (shared stem -- catches both) | -- | AGATCGGAAGAGC | | Nextera / Tn5 | transposase | CTGTCTCTTATACACATCT | | TruSeq small-RNA | 3' | TGGAATTCTCGGGTGCCAAGG |

The R1 3' adapter is the reverse complement of the R2-side region; trimming the shared 13 bp stem AGATCGGAAGAGC on both mates catches TruSeq read-through.

Tool Taxonomy

| Tool | Mechanism | When it wins | |------|-----------|--------------| | Cutadapt | Error-tolerant semiglobal alignment of a supplied adapter | PRECISION: small-RNA 3' adapter, amplicon/16S primers, anchored/linked adapters, demultiplexing. The correctness reference. | | Trimmomatic | ILLUMINACLIP simple + palindrome modes; ordered step pipeline | Legacy/reproducibility pipelines; palindrome PE read-through detection | | fastp | PE overlap analysis (no adapter sequence needed) + auto poly-G | DEFAULT general-purpose trim; one fast pass (route OUT -> fastp-workflow) | | Trim Galore | Cutadapt + FastQC wrapper with adapter auto-detect | Bisulfite/RRBS (--rrbs), Bismark pipelines | | BBDuk | k-mer match against an adapter/contaminant reference | Contaminant/PhiX removal in the same pass (route OUT -> contamination-screening) |

Decision Tree by Scenario

| Scenario | Use | Why | |----------|-----|-----| | General Illumina PE WGS/WES/RNA | fastp, or cutadapt with the TruSeq stem | Overlap analysis needs no sequence; cutadapt for explicit control | | Small-RNA / miRNA | cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmed | Adapter on every read; gate length and drop no-adapter reads | | Amplicon / 16S primers | cutadapt linked/anchored adapters | Primers are at fixed positions; needs precise placement | | PE read-through, no adapter sequence known | fastp overlap, or Trimmomatic palindrome | Both detect read-through from the R1/R2 overlap | | Bisulfite / RRBS | Trim Galore --rrbs | Handles MspI fill-in and Bismark conventions | | NextSeq/NovaSeq with poly-G tails | fastp (auto) or cutadapt --nextseq-trim | Poly-G is high-Q; quality trim alone misses it |

Default when uncertain: fastp for bulk PE, cutadapt with the TruSeq stem for explicit single-tool control.

Cutadapt

The algorithm is semiglobal (overlap) alignment, so a partial 3' adapter at the read end is detected. Two defaults drive behavior: -e (error rate, default 0.1) is computed against the LENGTH OF THE MATCHED REGION, not the whole adapter (an 8 bp match with 1 error is rate 0.125 and is rejected at the default); -O (minimum overlap, default 3) costs only ~0.07 bases lost per read by chance.

# Single-end 3' adapter
cutadapt -a AGATCGGAAGAGC -m 20 -o trimmed.fq.gz in.fq.gz

# Paired-end TruSeq (shared stem on both mates); both reads of a pair are discarded together
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -m 20:20 \
         -o R1.fq.gz -p R2.fq.gz in_R1.fq.gz in_R2.fq.gz

# Small-RNA: adapter on every read -> discard untrimmed, gate length
cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 18 -M 30 --discard-untrimmed -j 8 \
         -o mirna.fq.gz raw.fq.gz

# Amplicon: linked 5'...3' primers (anchor with ^ to require the 5' primer)
cutadapt -g ^FWDPRIMER...REVPRIMER -o trimmed.fq.gz in.fq.gz

# 2-color poly-G aware (treats G as low quality so high-Q poly-G is trimmed)
cutadapt --nextseq-trim=20 -a AGATCGGAAGAGC -m 20 -o out.fq.gz in.fq.gz

# Higher error tolerance / longer required overlap when matches are missed / spurious
cutadapt -a ADAPTER -e 0.15 -O 5 -m 20 -o out.fq.gz in.fq.gz

Key flags: -a/-g/-b (3'/5'/anywhere, R1), -A/-G/-B (R2), -q (quality trim, BWA running-sum, runs BEFORE adapter removal), --pair-filter {any,both,first} (default any), --max-n, --action {trim,mask,lowercase,none}. When a filtering option discards reads in PE mode, both files MUST be processed together or they fall out of sync.

Trimmomatic

ILLUMINACLIP:<adapters.fa>:<seedMismatches>:<palindromeClip>:<simpleClip>:<minAdapterLen>:<keepBothReads>

  • seedMismatches: mismatches tolerated in the initial seed (commonly 2).
  • palindromeClip (~30): log-odds threshold for the PE palindrome alignment; ~30 needs ~50 matched bases.
  • simpleClip (~10): log-odds threshold for an adapter-vs-read match; ~10 needs ~16 bases.
  • keepBothReads: DEFAULT False -- after palindrome detects read-through, R2 is redundant (reverse complement of R1) and is DROPPED; set True if a downstream tool needs both mates.

SIMPLE mode tests each adapter against each read. PALINDROME mode (PE-only) aligns R1+adapter against the reverse complement of R2+adapter, so it detects read-through even when only a few adapter bases remain or the adapter is entirely past the read end. Steps run in COMMAND-LINE ORDER; put ILLUMINACLIP first and MINLEN last so the length check reflects all prior trimming.

# Paired-end, palindrome-capable adapter file, MINLEN last
trimmomatic PE -phred33 -threads 8 \
    in_R1.fq.gz in_R2.fq.gz \
    R1_paired.fq.gz R1_unpaired.fq.gz R2_paired.fq.gz R2_unpaired.fq.gz \
    ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10:2:keepBothReads MINLEN:36

# Built-in adapter files ship with the install
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/

PE mode emits FOUR files: paired (both mates survived) and unpaired/orphan (mate dropped). Feed the paired files to the aligner; the orphans stay synchronized out of the way.

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | FastQC still shows adapter after trimming | Wrong adapter, too-low -e, or only partial stem used | Use the shared stem AGATCGGAAGAGC; raise -e to 0.15; BLAST the overrepresented sequence | | Reads truncated / many lose a few bp | -O too low -> random 3-mer matches | Raise -O (e.g. 5); the default loses ~0.07 bp/read by chance | | Aligner reports R1/R2 out of sync | Mates trimmed/filtered independently | Process pairs together (cutadapt -p; Trimmomatic paired outputs) | | Small-RNA yields huge "reads" | Forgot --discard-untrimmed / length gate | Add --discard-untrimmed -m 18 -M 30 | | 3' G-content rise persists after trimming | 2-color poly-G is high-quality, not adapter | cutadapt --nextseq-trim or fastp auto poly-G | | Half of R2 disappears in Trimmomatic | keepBothReads default False drops redundant R2 | Add keepBothReads (True) if both mates are needed downstream |

References

Martin M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17(1):10-12. Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114-2120. MacManes MD. 2014. On the optimal trimming of high-throughput mRNA sequence data. Frontiers in Genetics 5:13. Williams CR, Baccarella A, Parrish JZ, Kim CC. 2016. Trimming of sequence reads alters RNA-Seq gene expression estimates. BMC Bioinformatics 17:103. Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890.

Related Skills

read-qc/quality-reports - Read the adapter-content panel that triggers trimming read-qc/quality-filtering - Quality and length filtering after adapter removal read-qc/fastp-workflow - All-in-one adapter + quality trim with auto poly-G read-qc/contamination-screening - k-mer removal of PhiX/vector/contaminant sequence small-rna-seq/smrna-preprocessing - Full small-RNA adapter + length workflow read-alignment/bwa-alignment - Soft-clipping aligner that handles low-quality tails without trimming

<!-- END FILE: read-qc/adapter-trimming/SKILL.md -->

子目录:read-qc/contamination-screening

<!-- BEGIN FILE: read-qc/contamination-screening/SKILL.md -->

name: bio-read-qc-contamination-screening description: Detects contamination in sequencing reads - cross-species (FastQ Screen, Kraken2), vector/PhiX/adapter, rRNA, and same-species cross-sample/index-hopping and sample swaps (SNP fingerprints via verifyBamID2/NGSCheckMate/somalier). Use when suspecting cross-contamination, PDX host reads, microbial carry-over, or sample swaps, and to decide whether to report, filter, or align to a combined reference. For deep taxonomic profiling use metagenomics/kraken-classification. tool_type: cli primary_tool: fastq_screen

Version Compatibility

Reference examples tested with: FastQ Screen 0.15+, Bowtie2 2.5+, Kraken2 2.1+, BBTools 39.0+, MultiQC 1.21+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Contamination Screening -- a species screen cannot see a same-species swap

Screen reads against a genome panel (FastQ Screen / Kraken2) for foreign ORGANISMS, and against SNP fingerprints for foreign or wrong INDIVIDUALS.

"Check my reads for contamination" -> Map a subsample against multiple references and/or fingerprint sample identity to find foreign DNA and mislabels.

  • CLI: fastq_screen --conf fastq_screen.conf sample.fastq.gz (cross-species)
  • CLI: verifyBamID2 --SVDPrefix resource --BamFile sample.bam (same-species contamination)

Scope: this skill OWNS contamination detection and the report-vs-filter decision. Deep taxonomic profiling/abundance -> metagenomics/kraken-classification, metagenomics/metaphlan-profiling. rRNA depletion as an RNA prep metric -> read-qc/rnaseq-qc. OUT OF SCOPE: adapter removal (read-qc/adapter-trimming).

The Single Most Important Modern Insight

  1. A SPECIES screen answers "what ORGANISMS are here?"; a SNP FINGERPRINT answers "WHOSE DNA is this, and is it a mixture?" -- and these are orthogonal. A species screen is structurally BLIND to same-species cross-sample contamination and sample swaps: a human-A + human-B mixture, or a mislabeled human file, produces a perfectly clean single-species profile. Most pipelines run only a species screen and declare the data clean. Any human or single-species-cohort pipeline needs BOTH a taxonomic screen AND a SNP-fingerprint identity/contamination check (verifyBamID2, NGSCheckMate, somalier, conpair).

  2. Index hopping is the same-species contamination that lives inside one run, and unique dual indexing (UDI) is the only clean fix. On patterned flowcells (HiSeq X/4000, NovaSeq) ExAmp chemistry lets a free index adapter tag a fragment from another sample, spreading ~0.1-2% of reads into incorrect samples. Irrelevant for germline common variants, CATASTROPHIC for low-VAF work (ctDNA, single-cell, somatic) where hopped reads look like phantom low-frequency variants. Combinatorial indexing cannot detect it; UDI (a unique i7 AND i5 per sample) lets the demultiplexer drop impossible index pairs. UDI is effectively mandatory for ctDNA/plasma, single-cell, and low-input somatic.

  3. Default to SCREEN-AND-REPORT, not filter -- removing reads biases composition. A species screen is a QC gate; if a contaminant is low, aligning to the correct reference simply will not place the foreign reads. Filter only a specific, named contaminant (PhiX before assembly, adapters before alignment) with a precise k-mer remover (BBDuk ref=phix), never "remove anything that hits the screen" (that also discards conserved rRNA/mito reads that belong to the sample). For PDX, align to a COMBINED human+mouse reference and keep human-assigned reads, OR use a dedicated post-alignment classifier (XenofilteR benchmarks above Xenome for variant false-positive rate); both beat hard pre-filtering on one genome, which mis-assigns conserved-region reads.

Deeper trap: reference-genome contamination corrupts the screen itself. A "human" hit can be bacterial sequence mis-deposited inside the human assembly (Conterminator found >2M contaminated GenBank entries). No --confidence setting fixes a wrong database; trust a deconned/curated DB and treat surprising single-source hits as DB artifacts until ruled out.

The Contamination Taxonomy -- five classes, five fixes

| Class | What it is | Detect with | Fix | |-------|-----------|-------------|-----| | Cross-species | Mouse in human PDX; bacteria in culture | FastQ Screen, Kraken2/Bracken, sourmash, Xenome/XenofilteR | Combined-reference alignment; k-mer bin (report, do not blindly remove) | | Cross-sample / index hopping | Same-species reads on the wrong sample (INVISIBLE to species screens) | verifyBamID2, NGSCheckMate, somalier, conpair | UDI at prep; drop impossible index pairs at demux | | Vector / PhiX / adapter | Spike-in, cloning vector, linkers | UniVec/VecScreen; FastQ Screen adapter DB; BBDuk ref=phix/ref=adapters | k-mer trim/filter; upstream library QC | | rRNA over-representation | Library-prep failure, not contamination | SortMeRNA, ribodetector | Re-prep / better depletion; filter only to recover depth | | Cell-line: mycoplasma / misID | Mollicutes infection; HeLa cross-contamination | Kraken2 for Mollicutes; STR profiling for line identity | Clear culture or discard; STR-authenticate |

A pipeline that runs FastQ Screen and stops has checked exactly one of five boxes.

Tool Taxonomy

| Tool | Mechanism | When | |------|-----------|------| | FastQ Screen | Map a subsample to a genome panel; classify hit categories | Cross-species QC gate; the workhorse screen | | Kraken2 + Bracken | Exact-k-mer minimizer LCA classification; Bracken re-estimates abundance | Read-level taxonomy; many possible contaminants | | BBSplit / BBDuk | k-mer binning / named-contaminant k-mer removal | Decontamination of a NAMED contaminant (PhiX, adapters) | | Xenome / XenofilteR | Classify reads human vs mouse (k-mer / dual-alignment) | PDX host-graft disambiguation | | sourmash | MinHash/FracMinHash containment sketches | Fast low-memory "what is in here?" screen | | verifyBamID2 | Per-sample within-species contamination from population SNP AFs | Same-species contamination level (FREEMIX) | | NGSCheckMate / somalier | SNP-fingerprint identity / relatedness | Sample swaps, tumor-normal pairing, longitudinal identity | | conpair | Tumor-normal concordance + independent contamination | Matched T/N pairs |

Decision Tree by Scenario

| Question | Use | Why | |----------|-----|-----| | Is a foreign ORGANISM present? | FastQ Screen or Kraken2 | Maps reads to species references | | Is this the right INDIVIDUAL / one person? | NGSCheckMate / somalier | SNP fingerprint, species-screen-blind | | What is the contamination LEVEL (human)? | verifyBamID2 (FREEMIX) | Estimates mixture fraction from SNP AFs | | Tumor-normal pair: matched and clean? | conpair | Concordance + per-sample contamination | | PDX host vs graft | Combined reference or a benchmarked classifier | XenofilteR > Xenome for SNV FP rate; both beat hard pre-filtering | | Remove a NAMED contaminant | BBDuk ref=... | Precise k-mer removal, not "hits the screen" | | Strip HUMAN reads before public deposition (non-human library) | hostile / NCBI sra-human-scrubber (HRRT) | Deposition compliance, not a QC gate; a masked T2T reference avoids stripping conserved microbial regions |

Default when uncertain: FastQ Screen as the QC gate for organisms, PLUS a SNP-fingerprint check (somalier/NGSCheckMate) for any human cohort.

FastQ Screen

Maps a SUBSAMPLE (--subset, default 100000) with bowtie2 reporting >1 alignment, then classifies each read across the panel. Read the bar chart, not just "% mapped": contamination concentrates in One_hit_one_genome of an UNEXPECTED genome; homology (rRNA, mito, conserved loci) spreads into the *_multiple_genomes categories; high Hit_no_genomes means adapter dimer, a missing reference, or a novel organism (a diagnostic, not a verdict).

# Config: aligner binary + DATABASE lines (bowtie2 index prefixes)
cat > fastq_screen.conf <<'EOF'
BOWTIE2  /usr/local/bin/bowtie2
THREADS  8
DATABASE  Human  /refs/GRCh38_bt2/GRCh38
DATABASE  Mouse  /refs/GRCm39_bt2/GRCm39
DATABASE  Ecoli  /refs/Ecoli_bt2/Ecoli
DATABASE  PhiX   /refs/phix_bt2/phix
DATABASE  rRNA   /refs/rRNA_bt2/rRNA
EOF

fastq_screen --conf fastq_screen.conf --threads 8 --outdir screen/ *.fastq.gz
multiqc screen/                      # MultiQC parses *_screen.txt across samples

# Tag every read with a per-genome status, then extract a subset by pattern
fastq_screen --conf fastq_screen.conf --tag --filter 10000 sample.fastq.gz   # maps only to genome 1
fastq_screen --conf fastq_screen.conf --nohits sample.fastq.gz               # reads hitting nothing

--filter digits (one per genome, config order): 0=no map, 1=unique, 2=multi, 3=maps, 4=pass 0 or 1, 5=pass 0 or 2, -=ignore. --subset 0 screens the whole file; --bisulfite uses Bismark.

Kraken2 + Bracken (read-level taxonomy)

Default --confidence 0.0 over-reports a long tail of spurious low-abundance species (a few shared k-mers suffice); raise to 0.05-0.1 and keep --minimum-hit-groups 2 (or 3 for custom DBs). Kraken2 gives CLASSIFICATION; Bracken redistributes higher-rank reads to species for ABUNDANCE.

kraken2 --db /db/k2_standard --threads 8 --confidence 0.1 --paired \
        --report sample.kreport --use-names R1.fq.gz R2.fq.gz > sample.kraken
bracken -d /db/k2_standard -i sample.kreport -o sample.bracken -r 150 -l S

Same-species: SNP fingerprints and index hopping

# verifyBamID2: FREEMIX = contamination fraction (action threshold ~0.02);
# FREEMIX~0 with CHIPMIX~1 indicates a SWAP, not contamination.
# --SVDPrefix points to the panel resource that ships with verifyBamID2 (resource/1000g.phase3...).
verifyBamID2 --SVDPrefix /res/1000g.phase3.100k.b38.vcf.gz.dat --BamFile sample.bam --Reference ref.fa

# somalier: extract genome sketches, then relate to find swaps / identity across a cohort.
# --sites = somalier's released sites.<build>.vcf.gz (github releases), not a custom panel.
somalier extract -d sites/ --sites sites.hg38.vcf.gz -f ref.fa sample.bam
somalier relate sites/*.somalier            # off-diagonal identity flags swaps

# conpair (tumor-normal): concordance + independent per-sample contamination

Index hopping is mitigated at demultiplexing with UDI (drop impossible i7,i5 pairs); residual contamination is then quantified by the SNP-fingerprint tools above.

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | "Single species, data is clean" but a swap is suspected | Species screen is blind to same-species swaps | Run somalier / NGSCheckMate on SNP fingerprints | | Phantom low-VAF variants in ctDNA/single-cell | Index hopping on patterned flowcell | Use UDI; quantify residual with verifyBamID2/conpair | | Kraken2 reports dozens of trace species | Default confidence 0.0 over-reports | Raise --confidence to 0.05-0.1; raise hit-groups | | A "human" Kraken hit on a microbial isolate | Reference/DB contamination | Use a deconned DB; treat as artifact until confirmed | | Filtering "contaminant" reads skews composition | Removed conserved rRNA/mito too | Remove a NAMED contaminant with BBDuk, not "hits the screen" | | PDX human counts look biased | Hard pre-filtering of ambiguous reads | Align to combined human+mouse reference instead |

References

Wingett SW, Andrews S. 2018. FastQ Screen: a tool for multi-genome mapping and quality control. F1000Research 7:1338. Wood DE, Lu J, Langmead B. 2019. Improved metagenomic analysis with Kraken 2. Genome Biology 20:257. Lu J, Breitwieser FP, Thielen P, Salzberg SL. 2017. Bracken: estimating species abundance in metagenomics data. PeerJ Computer Science 3:e104. Steinegger M, Salzberg SL. 2020. Terminating contamination: large-scale search identifies more than 2,000,000 contaminated entries in GenBank. Genome Biology 21:115. Conway T, Wazny J, Bromage A, et al. 2012. Xenome - a tool for classifying reads from xenograft samples. Bioinformatics 28(12):i172-i178. Costello M, Fleharty M, Abreu J, et al. 2018. Characterization and remediation of sample index swaps by non-redundant dual indexing. BMC Genomics 19:332. Zhang F, Flickinger M, Taliun SAG, et al. 2020. Ancestry-agnostic estimation of DNA sample contamination from sequence reads. Genome Research 30(2):185-194. Lee S, Lee S, Ouellette S, Park WY, Lee EA, Park PJ. 2017. NGSCheckMate: software for validating sample identity in next-generation sequencing studies within and across data types. Nucleic Acids Research 45(11):e103. Pedersen BS, Bhetariya PJ, Brown J, et al. 2020. Somalier: rapid relatedness estimation for cancer and germline studies using efficient genome sketches. Genome Medicine 12:62.

Related Skills

read-qc/quality-reports - Bimodal GC and overrepresented sequences flag contamination read-qc/adapter-trimming - Remove adapter contamination read-qc/rnaseq-qc - rRNA fraction as a prep-efficiency metric metagenomics/kraken-classification - Deeper taxonomic classification and profiling variant-calling/joint-calling - Where SNP-fingerprint sample swaps do the most damage

<!-- END FILE: read-qc/contamination-screening/SKILL.md -->

子目录:read-qc/fastp-workflow

<!-- BEGIN FILE: read-qc/fastp-workflow/SKILL.md -->

name: bio-read-qc-fastp-workflow description: Runs all-in-one FASTQ preprocessing with fastp in a single pass - adapter trimming via paired-end overlap analysis, quality/length filtering, 2-color poly-G removal, base correction, optional dedup/UMI/merge, and HTML/JSON reports. Use when preprocessing bulk Illumina data and wanting one fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps. For precise small-RNA/amplicon adapters use adapter-trimming; for molecule-accurate UMI dedup use umi-processing. tool_type: cli primary_tool: fastp

Version Compatibility

Reference examples tested with: fastp 0.23+, FastQC 0.12+, MultiQC 1.21+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

fastp Workflow -- one C++ pass for adapter, quality, poly-G, and QC

Run adapter trimming, quality/length filtering, poly-G removal, and reporting in a single fast pass.

"Preprocess my reads with fastp" -> Trim adapters from the read overlap, filter low-quality reads, remove 2-color poly-G, and emit an HTML/JSON report.

  • CLI: fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz -h report.html -j report.json

Scope: this skill OWNS general-purpose single-pass Illumina preprocessing. Precise small-RNA/amplicon/anchored adapters -> read-qc/adapter-trimming. Molecule-accurate UMI dedup/consensus -> read-qc/umi-processing. DNA coordinate dedup -> alignment-files/duplicate-handling. OUT OF SCOPE: transcriptome QC (read-qc/rnaseq-qc).

The Single Most Important Modern Insight

  1. fastp trims paired-end adapters by OVERLAP ANALYSIS, needing no adapter sequence at all. It aligns R1 against the reverse complement of R2, finds the insert-derived overlap, and trims whatever extends past it (the read-through region) -- so it can trim adapter down to a SINGLE trailing base, where sequence-matching tools need at least 3. The same overlap drives --correction (-c): where the mates disagree and one base is high-quality and the other very low, fastp overwrites the low-quality base with the high-quality call. This overlap machinery is why fastp is the default bulk PE preprocessor and why it needs no --adapter_sequence for standard libraries.

  2. --dedup is SEQUENCE-identity deduplication at the FASTQ level -- no coordinates, no UMI -- so it removes BIOLOGICAL duplicates too. It cannot tell a PCR duplicate from a highly expressed transcript's fragment or a targeted amplicon. NEVER use --dedup for RNA-seq quantification, amplicon, or any assay where identical reads are genuine signal. For molecule-accurate removal use UMIs (read-qc/umi-processing); for DNA variant calling use coordinate-based dedup AFTER alignment (alignment-files/duplicate-handling). fastp --dedup is for the narrow case of removing exact-duplicate reads from a non-UMI library where that is known to be safe.

  3. Poly-G trimming auto-enables for 2-color instruments (NextSeq/NovaSeq) from the machine ID, because G is the no-signal call. Leave it on; a high-quality poly-G tail is invisible to the quality filter. One fast pass does adapter + quality + poly-G + filtering + QC report, and the JSON feeds MultiQC -- but fastp does NOT replace cutadapt's precision for small-RNA 3' adapters, amplicon primers, or anchored/linked adapters.

Tool Positioning

| Need | Use fastp? | Alternative | |------|-----------|-------------| | Bulk PE WGS/WES/RNA/cfDNA preprocessing | Yes (default) | -- | | One pass: trim + filter + poly-G + QC report | Yes | -- | | Small-RNA 3' adapter + tight length gate | No | cutadapt (read-qc/adapter-trimming) | | Amplicon / anchored / linked primers | No | cutadapt | | Molecule counting / ctDNA consensus | Extract only | umi_tools / fgbio (read-qc/umi-processing) | | RNA-seq molecule dedup | No (--dedup is wrong) | UMIs, or do not dedup |

Core Operations

# Single-end and paired-end basics
fastp -i in.fq.gz -o out.fq.gz
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz

# Adapter: PE overlap is automatic; --detect_adapter_for_pe ADDS sequence-based detection on top
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --detect_adapter_for_pe
# Manual adapter sequences (SE auto-detects from data by default)
fastp -i in.fq.gz -o out.fq.gz --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

# Quality FILTER (per-read): base <Q20 unqualified; drop if >40% unqualified or >5 Ns
fastp -i in.fq.gz -o out.fq.gz -q 20 -u 40 -n 5
# Quality TRIM (sliding window from 3', SLIDINGWINDOW analogue) + length gate
fastp -i in.fq.gz -o out.fq.gz --cut_right --cut_window_size 4 --cut_mean_quality 20 -l 36

# 2-color poly-G (auto for NextSeq/NovaSeq); poly-X for 3' poly-A etc.
fastp -i in.fq.gz -o out.fq.gz --trim_poly_g          # --poly_g_min_len 10 default
fastp -i in.fq.gz -o out.fq.gz --trim_poly_x

# Overlap base correction (PE only; high-Q mate fixes low-Q base)
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --correction

# Merge overlapping pairs (short inserts: cfDNA, small-RNA, aDNA). Produces THREE streams:
# the merged file is single-end (full insert) and un_R1/un_R2 stay paired -- align them separately
# (merged as SE, un_R1/un_R2 as PE) and combine the BAMs.
fastp -i R1.fq.gz -I R2.fq.gz --merge --merged_out merged.fq.gz -o un_R1.fq.gz -O un_R2.fq.gz

# UMI extraction: fastp moves the inline UMI out of the read before trimming; molecule-accurate
# dedup/consensus still happens AFTER alignment (umi_tools/fgbio), not in fastp
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --umi --umi_loc read1 --umi_len 8

Key flags: -q qualified quality (default 15), -u unqualified percent limit (40), -n N limit (5), -e average-quality filter (0=off), -l length required (15), --length_limit (0=off), --cut_right/--cut_front/--cut_tail window cut modes (off by default), --cut_window_size (4), --cut_mean_quality (Q20), --thread/-w (default 3), -h/-j HTML/JSON report.

Complete Workflows

# Standard Illumina PE (4-color: HiSeq/MiSeq)
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
      --detect_adapter_for_pe --cut_right --cut_window_size 4 --cut_mean_quality 20 \
      -q 20 -l 36 -w 8 -h sample.html -j sample.json

# NovaSeq / NextSeq (2-color): add poly-G (auto, but explicit for clarity)
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
      --detect_adapter_for_pe --trim_poly_g \
      --cut_right --cut_window_size 4 --cut_mean_quality 20 -q 20 -l 36 -w 8 \
      -h sample.html -j sample.json

# RNA-seq: light trim only (aligner soft-clips; do NOT --dedup), longer min length
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
      --detect_adapter_for_pe -q 20 -l 50 -w 8 -h sample.html -j sample.json

Parsing the JSON report

import json

with open('sample.json') as f:
    report = json.load(f)

after = report['summary']['after_filtering']
print(f"reads kept: {after['total_reads']}, Q30: {after['q30_rate']:.2%}")
print(f"duplication: {report['duplication']['rate']:.2%}")    # diagnostic only -- do not auto-dedup

MultiQC parses fastp JSON directly: multiqc . over a directory of *.json builds the cohort report (read-qc/quality-reports).

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | RNA-seq counts deflated after fastp | Used --dedup (sequence dedup removes biological dups) | Drop --dedup for RNA-seq; never sequence-dedup expression data | | Adapter not trimmed (SE) | SE has no overlap; relies on data auto-detect | Pass --adapter_sequence explicitly for SE | | Poly-G remains | 4-color run, or auto-detect missed the instrument | Add --trim_poly_g explicitly | | Small-RNA results poor | fastp overlap is not precise enough for ~22 nt inserts | Use cutadapt with --discard-untrimmed (read-qc/adapter-trimming) | | Over-trimmed RNA-seq | Aggressive --cut_right quality | Light trim only; aligner soft-clips (read-qc/quality-filtering) | | UMI dedup expected but none happened | --umi only EXTRACTS; dedup is post-alignment | Extract here, dedup with umi_tools/fgbio after mapping (read-qc/umi-processing) |

References

Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890. Chen S. 2023. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2(2):e107. Ewels P, Magnusson M, Lundin S, Kaller M. 2016. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32(19):3047-3048.

Related Skills

read-qc/adapter-trimming - Precise adapter/primer control for small-RNA and amplicon read-qc/quality-filtering - Detailed quality/length filtering options and the trim-light evidence base read-qc/quality-reports - Aggregate fastp JSON across samples with MultiQC read-qc/umi-processing - Molecule-accurate UMI dedup and consensus after alignment alignment-files/duplicate-handling - Coordinate-based duplicate marking for DNA variant calling

<!-- END FILE: read-qc/fastp-workflow/SKILL.md -->

子目录:read-qc/quality-filtering

<!-- BEGIN FILE: read-qc/quality-filtering/SKILL.md -->

name: bio-read-qc-quality-filtering description: Filters reads by quality, length, N content, and complexity with Trimmomatic, fastp, and Cutadapt, including sliding-window trimming, per-read unqualified-base filtering, and 2-color poly-G removal. Use when reads have poor-quality tails, when an assembly or k-mer workflow needs clean input, or when a junk read subpopulation must be dropped. For adapter removal use adapter-trimming; for all-in-one preprocessing use fastp-workflow. tool_type: cli primary_tool: trimmomatic

Version Compatibility

Reference examples tested with: Trimmomatic 0.39+, fastp 0.23+, Cutadapt 4.4+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Quality Filtering -- trim lightly or not at all, and never without a length filter

Trim low-quality bases and drop low-quality reads with Trimmomatic (sliding window / MAXINFO), fastp (per-read filter + window cut), or Cutadapt (BWA-style quality trim).

"Filter reads by quality" -> Remove low-quality bases and/or discard reads below quality/length thresholds.

  • CLI: fastp -i in.fq -o out.fq --cut_right -q 20 -l 36 (window trim + per-read filter + length gate)
  • CLI: trimmomatic SE in.fq out.fq SLIDINGWINDOW:4:20 MINLEN:36

Scope: this skill OWNS quality/length/N/complexity filtering. Adapter removal -> read-qc/adapter-trimming. Single-pass trim+QC -> read-qc/fastp-workflow. Reading the quality plots -> read-qc/quality-reports. OUT OF SCOPE: contamination removal (read-qc/contamination-screening).

The Single Most Important Modern Insight

  1. Modern local aligners SOFT-CLIP low-quality tails, so quality trimming is usually unnecessary -- and AGGRESSIVE quality trimming actively harms downstream results. Williams 2016 showed aggressive trimming changed expression estimates for >10% of genes; Del Fabbro 2013 showed stringent Q>30 DEGRADES de novo assembly; MacManes 2014 found gentle trimming (remove only Phred<2-5) optimal for RNA-seq; GATK discourages quality trimming because BQSR recalibrates qualities itself. Trim ADAPTER always (read-qc/adapter-trimming); quality-trim lightly or not at all before a soft-clipping aligner. The workflows that genuinely need quality trimming are assembly, k-mer/pseudo-alignment, small-RNA, amplicon, and variant calling WITHOUT BQSR.

  2. Quality FILTERING (drop whole reads) and quality TRIMMING (cut bases within a read) are different operations with different tools. fastp's -q/-u/-n filters whole reads by the fraction of unqualified bases; --cut_right / Trimmomatic SLIDINGWINDOW trims bases from a window scan. Filtering removes a junk subpopulation (a low-Q hump in the per-sequence-quality plot); trimming shortens reads with decayed tails. Choose by whether the problem is some bad reads or bad ends.

  3. A short post-trim read mis-maps, so quality trimming MUST be paired with a minimum-length filter. Williams 2016 showed that adding a post-trim min-length filter mitigates most of the expression distortion that trimming introduces, because over-trimmed fragments that would map spuriously are dropped instead. MINLEN (Trimmomatic, always last), -l (fastp), -m (cutadapt) are not optional add-ons; they are the safety mechanism that makes trimming safe.

Two-color note: on NextSeq/NovaSeq the quality scores are binned to four values (RTA3: 2, 12, 23, 37), so a sliding-window threshold like 4:15 partitions between the 12 and 23 bins rather than acting on a smooth gradient -- thresholds tuned on HiSeq-era 0-40 qualities behave differently. And poly-G tails are HIGH quality, so a quality filter does not remove them (use poly-G trimming).

Tool Taxonomy

| Tool | Mechanism | When it wins | |------|-----------|--------------| | fastp | Per-read unqualified-base filter (-q/-u/-n) + window cut (--cut_right) + auto poly-G | DEFAULT; one fast pass, filtering and trimming together | | Trimmomatic | SLIDINGWINDOW / MAXINFO window trim; ordered step pipeline; orphan handling | Legacy/reproducibility pipelines; MAXINFO length-vs-quality balance | | Cutadapt | -q BWA running-sum quality trim (combined with adapter removal) | When already running cutadapt for adapters; precise per-end control |

Decision Tree by Scenario

| Workflow | Quality trimming | Why | |----------|------------------|-----| | Alignment-based DNA/RNA (BWA-MEM, STAR, Bowtie2 local, HISAT2) | Light or none | Aligner soft-clips tails; aggressive trim distorts expression | | GATK variant calling with BQSR | None | BQSR recalibrates; trimming interferes | | De novo assembly | Moderate (~Q20) + min-length | Low-Q errors corrupt the de Bruijn graph; stringent Q>30 over-trims | | k-mer / pseudo-alignment (kallisto/salmon) | Light + adapter | Errors create phantom k-mers | | A junk read subpopulation (bimodal per-seq quality) | FILTER whole reads (-e/AVGQUAL) | Trimming cannot fix a globally bad read | | Variant calling WITHOUT BQSR | Moderate + min-length | No recalibration safety net |

Default when uncertain: trim adapter, apply a light window trim plus a minimum-length filter, then confirm with FastQC.

Trimmomatic

Steps run in COMMAND-LINE ORDER; put quality steps before MINLEN so the length check reflects all trimming.

# Single-end: light leading/trailing + window, length-gated
trimmomatic SE -phred33 in.fq.gz out.fq.gz \
    LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

# Paired-end (four outputs: paired + orphan)
trimmomatic PE -phred33 -threads 8 \
    R1.fq.gz R2.fq.gz \
    R1_paired.fq.gz R1_unpaired.fq.gz R2_paired.fq.gz R2_unpaired.fq.gz \
    SLIDINGWINDOW:4:20 MINLEN:36

# MAXINFO: adaptive length-vs-quality balance (strictness <0.2 favors length, >0.8 favors correctness)
trimmomatic SE in.fq.gz out.fq.gz MAXINFO:40:0.5 MINLEN:36

| Step | Meaning | |------|---------| | SLIDINGWINDOW:W:Q | scan 5'->3'; cut from the point where the W-bp window mean drops below Q | | MAXINFO:L:S | adaptive trim balancing target length L against error rate; strictness S in 0-1 | | LEADING:Q / TRAILING:Q | cut 5'/3' bases below Q (also removes N) | | MINLEN:L / AVGQUAL:Q | DROP read if shorter than L / if mean quality below Q | | CROP:L / HEADCROP:N | cap length / remove first N bases (do NOT HEADCROP random-hexamer bias -- see below) |

Do NOT HEADCROP the first ~12 bp of RNA-seq to "fix" the wavy per-base-content plot: that pattern is random-hexamer priming bias (Hansen 2010), not adapter, and trimming it just discards real data without removing the underlying bias.

fastp

fastp separates per-read FILTERING from window TRIMMING. Quality filtering is on by default (-q 15).

# Per-read quality filter: base < Q20 is 'unqualified'; drop read if >40% unqualified or >5 Ns
fastp -i in.fq.gz -o out.fq.gz -q 20 -u 40 -n 5 -l 36

# Window trim from the 3' (Trimmomatic SLIDINGWINDOW analogue) + length gate
fastp -i R1.fq.gz -I R2.fq.gz -o R1.fq.gz -O R2.fq.gz \
      --cut_right --cut_window_size 4 --cut_mean_quality 20 -l 36

# Drop globally low-quality reads by mean quality (filter, not trim)
fastp -i in.fq.gz -o out.fq.gz -e 25

# 2-color poly-G (auto-enabled for NextSeq/NovaSeq from the instrument ID)
fastp -i in.fq.gz -o out.fq.gz --trim_poly_g

# Low-complexity filter (e.g. poly-A / homopolymer-rich reads)
fastp -i in.fq.gz -o out.fq.gz --low_complexity_filter --complexity_threshold 30

fastp flags: -q qualified quality (default 15), -u unqualified percent limit (default 40), -n N base limit (default 5), -e average-quality filter (default 0 = off), -l length required (default 15), --length_limit max length (long form only), --cut_front/--cut_tail/--cut_right window cut modes (off by default), --cut_window_size (4), --cut_mean_quality (Q20).

Cutadapt

-q uses the BWA running-partial-sum algorithm, not a fixed cutoff, so a single high-Q base inside a low-Q run does not stop trimming. Quality trimming runs BEFORE adapter removal.

# 3'-only quality trim with a length gate (5',3' form: -q 15,20)
cutadapt -q 20 -m 36 -o out.fq.gz in.fq.gz

# Combined adapter + light quality trim, paired
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC -q 20 -m 36 \
         -o R1.fq.gz -p R2.fq.gz R1.fq.gz R2.fq.gz

Quantitative Thresholds

| Parameter | Typical | Rationale | |-----------|---------|-----------| | Window quality | Q20 (4:20) | 1% error; light. Aggressive (Q25-30) distorts expression/assembly (Williams 2016, Del Fabbro 2013) | | fastp -q / -u | Q15 / 40% | fastp defaults; a base under Q15 is unqualified, read dropped if >40% unqualified | | MINLEN / -l / -m | 36 (150 bp reads) | Mandatory after trimming; short reads mis-map. Scale up for longer inserts | | complexity_threshold | 30 (30%) | fastp default for low-complexity filtering | | MAXINFO strictness | 0.2-0.8 | <0.2 favors length, >0.8 favors correctness |

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | Expression estimates shift for many genes | Aggressive quality trimming | Trim lightly; always add a min-length filter (Williams 2016) | | Variant calling worse after trimming | Trimmed before/around BQSR | Do not quality-trim for GATK BQSR workflows | | Window threshold behaves oddly on NovaSeq | Binned quality (4 values) makes windows coarse | Expect step-like behavior; do not port HiSeq thresholds blindly | | Reads mis-map after trimming | No min-length filter, over-trimmed fragments | Add MINLEN / -l / -m | | Poly-G tails survive quality filtering | Poly-G is high quality on 2-color | Use --trim_poly_g / cutadapt --nextseq-trim | | R1/R2 out of sync | Independent SE trimming of mates | Use Trimmomatic paired outputs or fastp/cutadapt paired mode |

References

Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15):2114-2120. Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890. MacManes MD. 2014. On the optimal trimming of high-throughput mRNA sequence data. Frontiers in Genetics 5:13. Del Fabbro C, Scalabrin S, Morgante M, Giorgi FM. 2013. An extensive evaluation of read trimming effects on Illumina NGS data analysis. PLoS ONE 8(12):e85024. Williams CR, Baccarella A, Parrish JZ, Kim CC. 2016. Trimming of sequence reads alters RNA-Seq gene expression estimates. BMC Bioinformatics 17:103. Hansen KD, Brenner SE, Dudoit S. 2010. Biases in Illumina transcriptome sequencing caused by random hexamer priming. Nucleic Acids Research 38(12):e131.

Related Skills

read-qc/adapter-trimming - Remove adapter before quality filtering read-qc/quality-reports - Read the quality plots that motivate filtering read-qc/fastp-workflow - All-in-one preprocessing in a single pass read-alignment/bwa-alignment - Soft-clipping aligner that absorbs low-quality tails read-alignment/star-alignment - Soft-clipping RNA aligner (light trimming preferred)

<!-- END FILE: read-qc/quality-filtering/SKILL.md -->

子目录:read-qc/quality-reports

<!-- BEGIN FILE: read-qc/quality-reports/SKILL.md -->

name: bio-read-qc-quality-reports description: Generates and interprets per-file and cross-sample QC reports from FASTQ data with FastQC, falco, and MultiQC, covering Phred quality, per-base composition, GC, duplication, overrepresented sequences, and adapter content. Use when performing initial QC on raw sequencing reads, validating preprocessing, or judging a multi-sample cohort for outliers and batch effects. For long reads use NanoPlot; for adapter/quality remediation route to adapter-trimming, quality-filtering, or fastp-workflow. tool_type: cli primary_tool: fastqc

Version Compatibility

Reference examples tested with: FastQC 0.12+, MultiQC 1.21+, falco 1.2+, seqkit 2.5+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Quality Reports -- the traffic light is a hypothesis about WGS DNA, not a verdict

Generate per-file QC with FastQC/falco and aggregate the cohort with MultiQC, then READ THE PLOTS against the assay rather than trusting pass/warn/fail.

"Run quality control on FASTQ files" -> Compute per-base quality, composition, GC, duplication, and adapter profiles per file, then aggregate across samples to find outliers.

  • CLI: fastqc -t 8 *.fastq.gz then multiqc .
  • Long reads: NanoPlot --fastq reads.fastq.gz (FastQC assumes fixed-length short reads)

Scope: this skill OWNS raw-FASTQ QC reporting and interpretation, and carries the cross-cutting quality-score / chemistry / duplication concepts the rest of read-qc depends on. Remediation lives elsewhere -> read-qc/adapter-trimming, read-qc/quality-filtering, read-qc/fastp-workflow. Contamination -> read-qc/contamination-screening. Transcriptome QC on the BAM -> read-qc/rnaseq-qc. OUT OF SCOPE: any modification of the reads.

The Single Most Important Modern Insight

  1. FastQC pass/warn/fail are heuristics calibrated to random whole-genome DNA, so they FALSE-FAIL on every other assay. RNA-seq fails per-base content (random-hexamer bias) and duplication (high-expression molecules); amplicon fails duplication and GC by design; bisulfite fails base content (C->T conversion); small-RNA fails length distribution; single-cell R1 fails everything (it is barcode+UMI, not biology). A red light is a HYPOTHESIS about a WGS library. For any other protocol, first ask "is this module expected to deviate for this chemistry?" before treating the red as a defect. Read the plot shape; the traffic light is calibration noise.

  2. On 2-color chemistry (NextSeq, NovaSeq, MiniSeq) G is the ABSENCE of signal, so poly-G tails are called at HIGH quality and the quality plot will NOT flag them. When a cluster runs out of template, dark cycles read as a run of Gs with high confidence. Quality trimming alone does not remove them. They surface as a 3'-end RISE in G content (per-base sequence content) and a spurious high-GC spike, and they mis-map or manufacture false somatic variants if left in. The fix is a chemistry-aware poly-G trim (fastp auto-enables it from the instrument ID; cutadapt --nextseq-trim), not a quality cutoff. Read the per-base CONTENT plot on any 2-color run, not just the quality plot.

  3. The duplication percentage is read-level and complexity-blind: it cannot tell a PCR jackpot from genuine high abundance. Identical reads from a highly expressed transcript, a targeted amplicon, or a ChIP/ATAC peak are counted as duplicates even though they are independent biological molecules. Duplication % is a function of BOTH library complexity AND sequencing depth (a good library sequenced deeply shows high duplication). It is a PROMPT to reason about library complexity (preseq), never an automatic "remove duplicates" -- and removing duplicates in non-UMI RNA-seq is actively wrong (read-qc/umi-processing, read-qc/rnaseq-qc).

Bonus trap: NovaSeq/NextSeq emit BINNED quality scores (RTA3 uses four values: 2, 12, 23, 37), so FastQC box plots look blocky/quantized. This is the instrument's quality table, NOT bad data and NOT something to fix. The bin edges are RTA-version-specific (NovaSeq X / RTA4 differs) -- never hard-code one bin set.

Tool Taxonomy

| Tool | Role | Mechanism / when | |------|------|------------------| | FastQC | Per-file short-read QC (HTML + zip) | Java; the module set below; duplication/overrep from the first 100k distinct reads. The de-facto standard per-file report. | | falco | Drop-in FastQC re-implementation (C++) | ~3x faster, lower memory, same module names and MultiQC-compatible output. Use when FastQC throughput bottlenecks a large cohort. | | MultiQC | Cross-sample aggregator (SCRAPER, not a re-analyzer) | Walks directories, regex-matches each tool's log/report, parses the numbers, builds one cohort report. The unit of review for multi-sample studies. | | seqkit stats | Instant tabular FASTA/FASTQ numbers | seqkit stats -a: N50, Q20%, Q30%, GC%, length quartiles. For quick numbers and assembly/long-read contexts where FastQC is the wrong shape. | | NanoPlot / NanoComp | Long-read (ONT/PacBio) QC | Read-length and quality distributions, yield, N50, length-vs-quality. The correct first pass for long reads; FastQC's fixed-length assumptions break there. |

Decision Tree by Scenario

| Scenario | Use | Why | |----------|-----|-----| | Per-file Illumina short-read QC | FastQC (or falco) | Module-level diagnostics; read the plots by assay | | Many samples / a study cohort | FastQC/falco then MultiQC | Outlier and batch detection is RELATIVE; only visible overlaid | | Long reads (ONT/PacBio) | NanoPlot / NanoComp | FastQC is built for fixed-length short reads | | Instant numbers, assembly input | seqkit stats -a | N50/Q20/Q30/GC in one line; no HTML overhead | | Large cohort, FastQC too slow | falco then MultiQC | Same output, ~3x faster |

Default when uncertain: FastQC on each file, then MultiQC over the run directory, and judge each sample against the cohort.

FastQC Modules -- thresholds and the expert read

Thresholds are FastQC's limits.txt defaults (calibrated to random WGS DNA). The expert read is what to conclude BEYOND the traffic light.

| Module | Default warn / fail | Expert read | |--------|--------------------|-------------| | Per base sequence quality | warn LQ<10 or median<25; fail LQ<5 or median<20 | 3' decay is normal; blocky boxes on NovaSeq are binning; this plot will NOT reveal poly-G on 2-color | | Per tile sequence quality | spatial deviation (no numeric) | A hot tile band across cycles = a localized flowcell problem (bubble, debris, edge); reason no MultiQC table replaces raw FastQC | | Per sequence quality scores | distribution of per-read mean Q | A low-Q hump = a junk subpopulation to FILTER (not trim) | | Per base sequence content | warn dev>10%; fail dev>20% | First ~12 bp skew = random-hexamer priming (Hansen 2010), expected for RNA-seq, do NOT trim it. A 3'-end skew is poly-G / adapter -- act on that | | Per sequence GC content | warn dev>15%; fail dev>30% | SHAPE matters: bimodal/secondary peak = contamination; sharp spike = adapter dimer / overrepresented; a shifted single peak = wrong-GC reference assumption | | Per base N content | warn N>5%; fail N>20% | Ns at a fixed position = a failed cycle; rising 3' Ns = dying clusters | | Sequence length distribution | warn if lengths differ; fail if any length 0 | WARNs trivially after trimming and on long reads -- ignore for those | | Sequence duplication levels | warn if <70% would remain; fail if <50% | Read-level, complexity-blind (see insight 3); high = think complexity, not dedup | | Overrepresented sequences | warn >0.1%; fail >1% | Most diagnostic module: it prints the sequence -- BLAST it (adapter dimer, rRNA, primer, poly-G) | | Adapter content | warn k-mer>5%; fail >10% | A curve climbing toward 3' = read-through from short inserts; this panel IS an insert-size readout (route to adapter-trimming) | | K-mer content | (deprecated, off by default) | Only appears in old reports; do not build guidance on it |

Algorithm note (why duplication/overrep are estimates): FastQC tracks only the first 100,000 DISTINCT sequences, keys on the first 50 bp for reads >75 bp (so 3' errors do not fragment a duplicate family), counts by exact identity, and extrapolates the "% remaining if deduplicated" headline. It is a sample-based estimate, not a full-library dedup.

Duplication Taxonomy -- four causes, four actions

| Class | Mechanism | Detected by | Action | |-------|-----------|-------------|--------| | Optical | One real cluster mis-segmented (non-patterned flowcell) | Same tile, pixel distance (Picard default 100) | Removable; spatially local artifact | | ExAmp / patterned | One molecule seeds two nanowells (HiSeq X/4000, NovaSeq) | Spatially clustered, larger radius (Picard 2500 for patterned) | Removable; the reason patterned flowcells need the bigger pixel distance | | PCR | Same fragment amplified and sequenced twice | Identical 5' coordinates post-alignment (+UMI if present) | Mark/remove for variant calling; NEVER coordinate-dedup amplicon (use UMIs) | | Natural / biological | Independent identical molecules (high coverage, expressed genes, amplicon start) | Indistinguishable from PCR at read level without UMIs | KEEP -- removing biases quantification (do not dedup non-UMI RNA-seq) |

The read-level duplication % FastQC reports cannot separate these. Use preseq (Daley & Smith 2013) to model the complexity curve and ask "how many NEW molecules would more sequencing buy?" -- that curve, not a single %, judges whether a library is exhausted or just deeply sequenced.

Quality scores and encoding

Phred Q = -10*log10(P_error): Q20 = 1% error, Q30 = 0.1%, Q40 = 0.01%. Q30 is the routine Illumina target; bulk Q40+ is uncommon on legacy chemistry (phasing, signal decay) and is a tell for re-binned or synthetic data on old runs, though XLEAP-SBS (NovaSeq X, NextSeq 2000) genuinely reaches Q40+. Modern data is universally Phred+33; any Phred+64 file (Illumina 1.3-1.7) feeds 31-too-high scores to a +33-assuming tool and passes garbage silently -- convert it (seqtk seq -Q64 -V). A quality byte below ASCII 64 (digits/punctuation) proves +33; detection tools sample reads to break ties.

MultiQC -- the cohort is the unit of review

MultiQC does NOT re-analyze data; it scrapes tool logs/reports (search_patterns.yaml), parses the numbers, and tabulates them per sample. Consequences: it is only as good as the files left on disk and the sample-name parsing (name collisions merge samples -- check multiqc_data/multiqc_sources.txt), and it reports whatever the upstream tool wrote (a wrong reference or wrong strandedness shows as a coherent-but-wrong table, not an error). Read the General Statistics table FIRST -- outliers jump out as a column anomaly -- then overlay per-base-quality / GC / duplication and ask whether the low-quality set maps to one lane / prep batch / operator. The batch effect caught here at QC is the one not chased for a month in the DE results.

# Per-file QC, then aggregate the run
fastqc -t 8 -o qc/raw/ raw_data/*.fastq.gz
multiqc qc/raw/ -o qc/multiqc/ -f

# Compare before vs after trimming in one report
fastqc -t 8 -o qc/trimmed/ trimmed/*.fastq.gz
multiqc qc/ -o qc/compare/ -f          # picks up both raw/ and trimmed/

# Long reads do not go through FastQC
NanoPlot --fastq ont_reads.fastq.gz -o qc/nanoplot/

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | Every RNA-seq sample fails per-base content | Random-hexamer 5' bias (Hansen 2010) | Expected; do not trim the first bases | | High-Q reads but a 3' G-content rise on NovaSeq | 2-color poly-G (dark cycles = G) | Chemistry-aware poly-G trim (fastp / cutadapt --nextseq-trim), not -q | | FastQC quality boxes look quantized/blocky | NovaSeq/NextSeq binned qualities (RTA3) | Expected; not a defect, do not "fix" | | MultiQC merges two samples into one row | Over-aggressive name cleaning / collision | Check multiqc_sources.txt; use --fn_as_s_name or fix names | | Duplication 60%, urge to dedup RNA-seq | Read-level dup is complexity-blind | Do not dedup non-UMI RNA-seq; assess complexity (preseq) | | FastQC crashes / huge plot on long reads | Fixed-length short-read assumptions | Use NanoPlot / seqkit stats instead | | FastQC module missing in MultiQC | The fastqc_data.txt was not on disk / wrong dir | Point MultiQC at the directory holding the zip/data files |

References

de Sena Brandine G, Smith AD. 2019. Falco: high-speed FastQC emulation for quality control of sequencing data. F1000Research 8:1874. Ewing B, Hillier L, Wendl MC, Green P. 1998. Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Research 8(3):175-185. Ewing B, Green P. 1998. Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Research 8(3):186-194. Hansen KD, Brenner SE, Dudoit S. 2010. Biases in Illumina transcriptome sequencing caused by random hexamer priming. Nucleic Acids Research 38(12):e131. Daley T, Smith AD. 2013. Predicting the molecular complexity of sequencing libraries. Nature Methods 10(4):325-327. Ewels P, Magnusson M, Lundin S, Kaller M. 2016. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32(19):3047-3048. Shen W, Le S, Li Y, Hu F. 2016. SeqKit: a cross-platform and ultrafast toolkit for FASTA/Q file manipulation. PLoS ONE 11(10):e0163962. De Coster W, D'Hert S, Schultz DT, Cruts M, Van Broeckhoven C. 2018. NanoPack: visualizing and processing long-read sequencing data. Bioinformatics 34(15):2666-2669.

Related Skills

read-qc/adapter-trimming - Remove read-through adapter flagged by the adapter-content panel read-qc/quality-filtering - Drop low-quality reads and trim ends read-qc/fastp-workflow - All-in-one QC + trim, including 2-color poly-G read-qc/contamination-screening - Resolve a bimodal-GC or unexpected overrepresented-sequence signal read-qc/rnaseq-qc - Transcriptome QC (strandedness, gene-body coverage) on the aligned BAM sequence-io/sequence-statistics - Programmatic per-file sequence summaries

<!-- END FILE: read-qc/quality-reports/SKILL.md -->

子目录:read-qc/rnaseq-qc

<!-- BEGIN FILE: read-qc/rnaseq-qc/SKILL.md -->

name: bio-read-qc-rnaseq-qc description: Runs RNA-seq-specific post-alignment QC - strandedness inference, gene-body 5'-3' coverage, read distribution (exonic/intronic/intergenic), rRNA/globin/mitochondrial rate, transcript integrity (TIN), and saturation - with RSeQC, Qualimap, RNA-SeQC, and Picard. Use when validating RNA-seq libraries before quantification or differential expression, diagnosing degradation or gDNA contamination, or determining library strandedness. For raw-FASTQ QC use quality-reports; for UMI dedup use umi-processing. tool_type: mixed primary_tool: RSeQC

Version Compatibility

Reference examples tested with: RSeQC 5.0+, Qualimap 2.3+, RNA-SeQC 2.4+, Picard 3.1+, salmon 1.10+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

RNA-seq QC -- post-alignment metrics that have no DNA analogue

Assess strandedness, integrity, feature distribution, and enrichment on the ALIGNED BAM, using RSeQC / Qualimap / RNA-SeQC / Picard against a gene model.

"Run RNA-seq QC" -> Infer strandedness, gene-body coverage, exonic/intronic/intergenic distribution, rRNA rate, and TIN from the BAM.

  • CLI: infer_experiment.py -i aligned.bam -r genes.bed12 (strandedness)
  • CLI: picard CollectRnaSeqMetrics / qualimap rnaseq / rnaseqc collapsed.gtf in.bam out/

Scope: this skill OWNS transcriptome QC on the aligned BAM. Raw-FASTQ QC (adapters, base quality) -> read-qc/quality-reports. UMI dedup -> read-qc/umi-processing. Quantification -> rna-quantification/featurecounts-counting. OUT OF SCOPE: differential expression (differential-expression/deseq2-basics).

The Single Most Important Modern Insight

  1. These are POST-ALIGNMENT QC: every metric needs an aligned BAM AND a gene model (BED12 / GTF / refFlat / collapsed-GTF), which is the line that separates them from FastQC. FastQC answers "is the sequencer output clean?"; RNA-seq QC answers "did I sequence the transcriptome I think I sequenced, in the orientation I think, with the integrity I think?" The metrics below (strand, exonic rate, rRNA rate, 5'-3' bias) have no DNA analogue because DNA has no exons, no strand of transcription, and no rRNA fraction. The most common setup error is feeding the wrong gene-model format (RSeQC wants BED12; Qualimap a GTF; RNA-SeQC a COLLAPSED GTF; Picard a refFlat + ribosomal_intervals).

  2. Getting strandedness wrong SILENTLY HALVES OR ZEROS the counts -- no error is thrown. dUTP (TruSeq Stranded mRNA, most rRNA-depletion kits) is fr-firststrand = REVERSE = featureCounts -s 2 = htseq reverse = salmon ISR = STAR ReadsPerGene column 4. Run it as "forward" and reads land on the antisense gene: counts collapse toward zero and the antisense neighbor inflates (running stranded data as UNSTRANDED, by contrast, roughly doubles counts). The tell is a huge "assigned to no feature" fraction or counts ~2x below the unstranded run. ALWAYS infer strandedness empirically (infer_experiment.py, salmon -l A, or how_are_we_stranded_here) before quantifying -- never assume from the kit name.

  3. In standard bulk RNA-seq WITHOUT UMIs, do NOT mark or remove duplicates. A highly expressed gene legitimately produces many fragments sharing identical coordinates; at the read level a PCR duplicate and a natural duplicate are INDISTINGUISHABLE. Coordinate dedup (Picard MarkDuplicates) preferentially deletes reads from the most abundant and shortest transcripts, introducing an expression- and length-dependent bias. This is the OPPOSITE of DNA-seq. Duplication rate is a DIAGNOSTIC ("low complexity / over-sequenced / low input"), never a remove step. The only correct way to remove RNA PCR duplicates is UMIs (read-qc/umi-processing); UMI-protocol RNA-seq (QuantSeq, 10x) inverts the rule.

Integrity bonus: RIN is an electrophoresis estimate measured BEFORE library prep; gene-body coverage and TIN are the post-hoc TRUTH measured from the aligned reads. Use DV200 (% fragments >200 nt), not RIN, for FFPE/archival. In a cohort with variable quality, regress medTIN out as a covariate rather than discarding samples.

Tool Taxonomy

| Tool | Gene model | Role | |------|-----------|------| | RSeQC | BED12 | The script suite: infer_experiment, geneBody_coverage, read_distribution, tin, junction_saturation, read_duplication | | Qualimap 2 | GTF | qualimap rnaseq: feature distribution + transcript 5'-3' profile + junctions in one HTML (bamqc is the generic, non-RNA mode) | | RNA-SeQC 2 | COLLAPSED GTF | GTEx/TOPMed tool; scales to tens of thousands of samples; exonic/intronic/intergenic + rRNA rate + TPM | | Picard CollectRnaSeqMetrics | refFlat + ribosomal_intervals | PCT_CODING/UTR/INTRONIC/INTERGENIC/RIBOSOMAL, MEDIAN_5PRIME_TO_3PRIME_BIAS (cannot compute rRNA without the intervals) | | SortMeRNA | rRNA database | Filter/quantify rRNA reads directly |

QC-gate order: (1) FastQC on raw FASTQ -> (2) align (STAR/HISAT2) -> (3) post-alignment QC: strandedness FIRST (it gates correct quantification), then read distribution, gene-body + TIN, rRNA/globin/MT, duplication + saturation -> (4) aggregate with MultiQC and judge each sample against the cohort.

Strandedness -- infer, then set every tool to match

infer_experiment.py -i aligned.bam -r genes.bed12     # samples reads, reports the two fractions
salmon quant -i index -l A -r sample.fq.gz -o quant/  # -l A auto-detects; see lib_format_counts.json

| Protocol | infer_experiment dominant fraction | salmon -l (PE/SE) | featureCounts -s | htseq | STAR ReadsPerGene col | |----------|------------------------------------|-------------------|------------------|-------|-----------------------| | Unstranded | both ~0.5 | IU / U | 0 | no | 2 | | fr-secondstrand (forward) | "1++,1--,2+-,2-+" | ISF / SF | 1 | yes | 3 | | fr-firststrand (reverse, dUTP -- common) | "1+-,1-+,2++,2--" | ISR / SR | 2 | reverse | 4 |

Single-end infer_experiment drops the read-number prefix: forward = "++,--", reverse = "+-,-+". A STAR sanity check: the ReadsPerGene column with the most counts and fewest N_noFeature is the correct strand (the wrong column makes N_noFeature blow up). Picard STRAND_SPECIFICITY is a notorious inversion: NONE / FIRST_READ_TRANSCRIPTION_STRAND (= forward/fr-secondstrand) / SECOND_READ_TRANSCRIPTION_STRAND (= dUTP/reverse/fr-firststrand, the common case).

Gene-body coverage and integrity

geneBody_coverage.py -i aligned.bam -r genes.bed12 -o coverage   # 5'->3' uniformity curve
tin.py -i aligned.bam -r genes.bed12 > tin.txt                   # per-transcript integrity; medTIN = sample score

3' bias (coverage piling at the 3' end) = RNA degradation OR oligo-dT priming of degraded/FFPE RNA -- which is why poly-A protocols fail on FFPE and rRNA-depletion + random priming is preferred there. 5' bias is rarer (5'-capture protocols / artifacts). Flat = intact RNA. RIN/DV200/TIN: RIN (1-10, pre-prep, electrophoresis) predicts degradation; DV200 (% >200 nt) is the FFPE metric because fragmented RNA has no rRNA peaks for RIN; TIN is measured from the data and can be used as a DE covariate.

Read distribution and enrichment

read_distribution.py -i aligned.bam -r genes.bed12 > distribution.txt
  • High INTRONIC = pre-mRNA / nuclear RNA or gDNA contamination (in snRNA-seq it is SIGNAL, not a fail).
  • High INTERGENIC = gDNA contamination or annotation gaps. gDNA drives intronic AND intergenic up together; an annotation gap drives only intergenic.
  • rRNA rate = the readout of poly-A-selection / rRNA-depletion efficiency (high = wasted reads, failed depletion).
  • Globin (HBA/HBB) crowds whole-blood PAXgene libraries -- deplete (GLOBINclear); globin% is the readout.
  • Mitochondrial %: high = degradation (bulk) or dying cells / ambient contamination (single-cell; in snRNA-seq it should be LOW).

Duplication and saturation -- diagnostic, not a remove step

# Duplication as a DIAGNOSTIC only -- do NOT remove duplicates in non-UMI bulk RNA-seq
read_duplication.py -i aligned.bam -o dup                         # sequence- and mapping-based curves
junction_saturation.py -i aligned.bam -r genes.bed12 -o junc_sat  # enough depth for splicing?

Complete QC pipeline

Goal: Produce a per-sample RNA-seq QC summary covering strandedness, distribution, integrity, and Picard metrics.

Approach: Infer strandedness first, run the RSeQC suite, then Picard with STRAND_SPECIFICITY set to the inferred protocol, and append to one report (do NOT dedup).

#!/bin/bash
set -euo pipefail
SAMPLE=$1; BAM=$2; BED12=$3; REFFLAT=$4; RRNA_INTERVALS=$5
STRAND=${6:-SECOND_READ_TRANSCRIPTION_STRAND}   # SECOND = dUTP/reverse (common); FIRST = forward; NONE = unstranded

REPORT="${SAMPLE}_rnaseq_qc.txt"
echo "=== RNA-seq QC: $SAMPLE ===" > "$REPORT"

echo "--- Strandedness (set downstream tools to match) ---" >> "$REPORT"
infer_experiment.py -i "$BAM" -r "$BED12" >> "$REPORT"

echo "--- Read distribution ---" >> "$REPORT"
read_distribution.py -i "$BAM" -r "$BED12" >> "$REPORT"

geneBody_coverage.py -i "$BAM" -r "$BED12" -o "${SAMPLE}_genebody"
tin.py -i "$BAM" -r "$BED12"                       # writes <bam>.summary.txt (mean/median TIN) + <bam>.tin.xls
echo "--- TIN (medTIN = median column of the summary) ---" >> "$REPORT"
cat *.summary.txt >> "$REPORT" 2>/dev/null

echo "--- Picard RNA-seq metrics (STRAND=$STRAND) ---" >> "$REPORT"
picard CollectRnaSeqMetrics I="$BAM" O="${SAMPLE}_picard.txt" \
    REF_FLAT="$REFFLAT" STRAND_SPECIFICITY="$STRAND" RIBOSOMAL_INTERVALS="$RRNA_INTERVALS"

cat "$REPORT"

The collapsed gene model

A standard GTF lists many overlapping isoforms per gene, so a read that is exonic in isoform A but intronic in B is ambiguous and overlapping isoforms double-count the same base. RNA-SeQC 2 REQUIRES a COLLAPSED model (one flattened transcript per gene, inter-gene overlaps excluded), built with GTEx collapse_annotation.py. Mismatched or un-collapsed models are a leading cause of "my exonic rate looks wrong". Picard PCT_* metrics are FRACTIONS (0-1), not percentages, despite the name.

Quantitative Thresholds

| Metric | Anchor | Source / rationale | |--------|--------|--------------------| | Mapping rate | > 0.2 exclude below (GTEx); > 85% typical | GTEx v8 RNA-SeQC gate | | Intergenic rate | < 0.3 | GTEx; above = gDNA / annotation | | rRNA rate | < 0.3 (GTEx); <5% polyA, <10% depleted in practice | depletion efficiency | | Uniquely mapped reads | >= 30M (ENCODE human) | ENCODE long-RNA standard | | medTIN | > 70 good, 50-70 moderate, < 50 poor | RSeQC TIN | | 5'-to-3' bias | near 1 flat; > 2 strong degradation | Picard MEDIAN_5PRIME_TO_3PRIME_BIAS |

Thresholds are protocol-specific: an intronic rate that fails a poly-A bulk sample is normal/required for snRNA-seq (nuclei are >50% intronic); a 3' bias that condemns fresh poly-A is expected for FFPE. Apply cohort-relative outlier logic on top.

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | Counts ~halved / huge "no feature" fraction | Wrong strandedness | Infer first; set featureCounts/htseq/salmon/Picard to match | | RNA-seq DE has odd length bias | Marked duplicates on non-UMI bulk RNA-seq | Do not dedup; report duplication as a diagnostic | | Exonic rate looks wrong in RNA-SeQC | Un-collapsed multi-isoform GTF | Use a collapsed GTF (GTEx collapse_annotation.py) | | Picard rRNA metric is 0/blank | No ribosomal_intervals supplied | Build the interval list from rRNA features + BAM dict | | snRNA-seq "fails" high intronic rate | Bulk gate applied to nuclear RNA | Intronic reads are signal in snRNA; use an intron-inclusive reference | | Picard percentages look 100x too small | PCT_* are fractions (0-1) | Multiply by 100 for display |

References

Wang L, Wang S, Li W. 2012. RSeQC: quality control of RNA-seq experiments. Bioinformatics 28(16):2184-2185. Okonechnikov K, Conesa A, Garcia-Alcalde F. 2016. Qualimap 2: advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics 32(2):292-294. Graubert A, Aguet F, Ravi A, Ardlie KG, Getz G. 2021. RNA-SeQC 2: efficient RNA-seq quality control and quantification for large cohorts. Bioinformatics 37(18):3048-3050. Schroeder A, Mueller O, Stocker S, et al. 2006. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Molecular Biology 7:3. Wang L, Nie J, Sicotte H, et al. 2016. Measure transcript integrity using RNA-seq data. BMC Bioinformatics 17:58. Smith T, Heger A, Sudbery I. 2017. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Research 27(3):491-499.

Related Skills

read-qc/quality-reports - Raw-FASTQ QC before alignment read-qc/umi-processing - Molecule-accurate dedup for UMI RNA-seq read-qc/contamination-screening - rRNA and cross-species contamination read-alignment/star-alignment - Aligner that emits ReadsPerGene strandedness columns rna-quantification/featurecounts-counting - Strand-aware quantification after QC differential-expression/deseq2-basics - Use medTIN as a covariate in the design

<!-- END FILE: read-qc/rnaseq-qc/SKILL.md -->

子目录:read-qc/umi-processing

<!-- BEGIN FILE: read-qc/umi-processing/SKILL.md -->

name: bio-read-qc-umi-processing description: Extracts UMIs and collapses reads to original molecules with umi_tools (directional dedup) or builds error-corrected single-strand/duplex consensus reads with fgbio. Use when the library has UMIs and accurate molecule counting or below-sequencer-floor error correction is needed - single-cell, low-input RNA-seq, targeted panels, and ctDNA/liquid-biopsy rare-variant detection. For UMI extraction during QC use fastp-workflow; do not dedup non-UMI bulk RNA-seq. tool_type: cli primary_tool: umi_tools

Version Compatibility

Reference examples tested with: umi_tools 1.1+, fgbio 2.1+, samtools 1.19+, STAR 2.7+

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

UMI Processing -- count original molecules, or build a consensus below the error floor

Collapse PCR/optical duplicates by (coordinate + UMI) with umi_tools, or call error-corrected consensus reads with fgbio.

"Deduplicate reads using UMIs" -> Extract the UMI before alignment, then group reads by UMI + mapping position after alignment to count original molecules.

  • CLI: umi_tools extract -> align -> umi_tools dedup (molecule counting)
  • CLI: fgbio GroupReadsByUmi -> fgbio CallMolecularConsensusReads/CallDuplexConsensusReads (error correction)

Scope: this skill OWNS UMI extraction, dedup, and consensus calling. UMI extraction during QC -> read-qc/fastp-workflow. Single-cell matrices -> single-cell/preprocessing. Non-UMI DNA coordinate dedup -> alignment-files/duplicate-handling. OUT OF SCOPE: non-UMI bulk RNA-seq (do NOT dedup it -- read-qc/rnaseq-qc).

The Single Most Important Modern Insight

  1. UMIs resolve the PCR-vs-biological duplicate confound that coordinates alone cannot, by collapsing on (coordinate + UMI) instead of coordinate -- and this forces a hard pipeline order: extract UMI on the FASTQ, align, THEN dedup. Two reads at the same coordinate are the same molecule only if they also share a UMI; two independent molecules at one coordinate carry different UMIs. The confound dominates at high coverage, high expression, amplicon (every molecule shares the same primer-defined ends), and low input. Dedup cannot run before alignment because duplicate identity needs mapping COORDINATES; and extract must run before alignment so the aligner does not try to map the UMI bases as genomic sequence (extract moves the UMI into the read name / RX tag).

  2. umi_tools' DIRECTIONAL method (default) folds UMI errors back into their parent via a count-gradient rule; naive exact-UMI collapse OVER-counts. Sequencing/PCR errors inside the UMI mutate a true UMI into a 1-off neighbor that looks like a new molecule. Directional builds a directed graph where an edge a->b exists when they are within edit distance 1 AND n_a >= 2*n_b - 1 (the parent is at least ~twice the error child, because errors are rarer than originals), then collapses each network to one molecule. This is why directional beats cluster (single-linkage over-merges, under-counts) and unique (no error model, over-counts).

  3. UMI-tools COUNTS molecules; fgbio builds a CONSENSUS read to push the error rate BELOW the sequencer floor -- and only DUPLEX consensus reaches the ctDNA/MRD floor. Single-strand consensus (CallMolecularConsensusReads) votes within one strand's family and roughly halves errors, but cannot catch a lesion fixed into the molecule before the first copy (oxidative 8-oxo-G, C>T deamination). Duplex consensus (CallDuplexConsensusReads) keeps a base only where BOTH original strands agree -- a real mutation is on both strands, an artifact almost never -- reaching <1e-7 error for sub-0.1% VAF detection, at the cost of ~2x raw reads (families missing one strand are discarded).

Bridges: do NOT dedup non-UMI bulk RNA-seq (high-expression genes make genuine duplicate coordinates; read-qc/rnaseq-qc). CellRanger/STARsolo ALREADY UMI-collapse and emit a final matrix -- do not re-dedup their output. Deep amplicon needs LONGER UMIs because every molecule shares coordinates, so the UMI alone must separate them (4^L space; collisions under-count).

Tool Taxonomy

| Tool / command | Role | When | |----------------|------|------| | umi_tools extract | Move UMI from read into the header (FASTQ stage) | Inline UMIs before alignment | | umi_tools dedup | Collapse to one read per (coord + UMI) via directional | Molecule counting (bulk, targeted) | | umi_tools count | Emit a gene x cell molecule matrix | Single-cell from a tagged raw BAM | | umi_tools group | Tag reads with UG (group id) + BX (representative UMI), no dedup | Inspect grouping / feed consensus | | fgbio GroupReadsByUmi | Group reads into source-molecule families (MI tag) | First step of consensus calling | | fgbio CallMolecularConsensusReads | Single-strand consensus | Moderate-VAF error correction | | fgbio CallDuplexConsensusReads | Duplex consensus (both strands agree) | ctDNA / MRD sub-0.1% VAF | | fgbio FilterConsensusReads | Filter/mask untrustworthy consensus bases | Mandatory after consensus calling | | fastp --umi | Extract only (no dedup) | UMI extraction folded into QC (route OUT) |

Decision Tree by Scenario

| Goal | Use | Why | |------|-----|-----| | Count molecules (bulk/targeted RNA or DNA) | umi_tools dedup --method directional | Models UMI errors; the standard | | Single-cell molecule matrix | umi_tools count (tagged raw BAM) or the aligner's own collapse | per-cell + per-gene | | Already have a CellRanger/STARsolo matrix | nothing | It is already UMI-deduplicated | | Moderate-VAF somatic error correction | fgbio single-strand consensus | Halves errors | | ctDNA / MRD sub-0.1% VAF | fgbio duplex consensus + FilterConsensusReads | Below the single-strand floor | | Non-UMI bulk RNA-seq | do NOT dedup | Duplicate coordinates are biological |

Default when uncertain: umi_tools directional dedup for counting; fgbio duplex for ctDNA.

Extraction (FASTQ stage, before alignment)

--bc-pattern alphabet (string method): N = UMI base (extracted to the read name), C = cell barcode (extracted), X = a fixed/known base REATTACHED to the read (not discarded). True discard uses the regex method's (?P<discard_N>...) group, shown below.

# Inline 8 nt UMI at the start of R1
umi_tools extract --stdin=R1.fq.gz --read2-in=R2.fq.gz \
    --stdout=R1_umi.fq.gz --read2-out=R2_umi.fq.gz --bc-pattern=NNNNNNNN

# 10x 3' v3: 16 nt cell barcode + 12 nt UMI on R1
umi_tools extract --stdin=R1.fq.gz --read2-in=R2.fq.gz \
    --stdout=R1_umi.fq.gz --read2-out=R2_umi.fq.gz \
    --bc-pattern=CCCCCCCCCCCCCCCCNNNNNNNNNNNN

# Variable-position UMI with an anchor (regex method)
umi_tools extract --extract-method=regex --stdin=R1.fq.gz --stdout=R1_umi.fq.gz \
    --bc-pattern='(?P<umi_1>.{8})ATGC(?P<discard_1>.{4})'

# fgbio reads structure (M=UMI, T=template, C=cell, B=sample barcode, S=skip)
fgbio FastqToBam --input R1.fq.gz R2.fq.gz --read-structures 8M+T +T \
    --sample S1 --library L1 --output unmapped.bam      # UMI -> RX tag

umi_tools dedup (molecule counting)

samtools sort -o sorted.bam aligned.bam && samtools index sorted.bam

# Directional (default), paired, with the diagnostic edit-distance stats
umi_tools dedup -I sorted.bam -S dedup.bam --paired --output-stats=stats

# Single-cell from a RAW aligned BAM whose CB/UB are in tags (NOT a CellRanger BAM)
umi_tools count -I tagged.bam -S counts.tsv \
    --per-gene --gene-tag=XT --per-cell --cell-tag=CB \
    --umi-tag=UB --extract-umi-method=tag

| Method | Behavior | Verdict | |--------|----------|---------| | directional (default) | Count-gradient graph (n_a >= 2n_b-1); folds UMI errors into parent | Best; the default | | adjacency | Resolve each component by abundance, one edge out | Reasonable | | cluster | One molecule per connected component (single-linkage) | Over-merges, under-counts | | unique | Exact UMI only, no error model | Over-counts; only PCR-free/high-diversity | | percentile | Drop UMIs below 1% of mean count | Crude denoiser |

--edit-distance-threshold default 1; --output-stats writes the edit-distance file (observed-vs-null confirms UMI errors were collapsed); umi_tools group --output-bam writes UG + BX tags without deduplicating.

fgbio consensus (error correction)

# Group reads into source-molecule families (writes MI tag from raw RX)
fgbio GroupReadsByUmi --input mapped.bam --output grouped.bam --strategy adjacency --edits 1

# Single-strand consensus (--min-reads required; raise to >=2-3 when error correction matters)
fgbio CallMolecularConsensusReads --input grouped.bam --output consensus.bam --min-reads 3

# Duplex consensus for ctDNA: group with the paired strategy, then call duplex
fgbio GroupReadsByUmi --input mapped.bam --output grouped.bam --strategy paired --edits 1
fgbio CallDuplexConsensusReads --input grouped.bam --output duplex.bam --min-reads 2 1 1

# Mandatory final step: filter/mask untrustworthy consensus bases
fgbio FilterConsensusReads --input duplex.bam --output filtered.bam --ref ref.fa \
    --min-reads 2 1 1 --max-base-error-rate 0.1 --min-base-quality 40 --max-no-calls 0.2

GroupReadsByUmi --strategy: identity (exact), edit (cluster by edits), adjacency (umi_tools directional port), paired (DUPLEX -- a read with UMI A-B is the opposite strand of one with B-A, tagged MI .../A and .../B). The consensus pipeline aligns, groups, calls consensus, then RE-aligns the consensus reads (the sequence changed). RX = raw UMI, MI = molecular id (SAM tags).

Saturation and collision

A fully-random L-mer UMI has 4^L sequences (L=8 -> 65,536; L=12 -> ~16.8M). When the molecules at a locus approach the usable space, independent molecules COLLIDE on the same UMI and are under-counted. For bulk/RNA the key is coordinate+UMI, so the space is 4^L per coordinate and collisions are rare; for AMPLICON every molecule shares coordinates, so the UMI alone separates them and deep panels need longer UMIs (AmpUMI sizes this). UMIs do NOT fix capture/ligation bias upstream of tagging, errors before UMI attachment (only duplex does), or low library complexity.

Common Errors

| Symptom | Cause | Solution | |---------|-------|----------| | Re-running dedup on CellRanger output | CellRanger/STARsolo already UMI-collapse | Use their matrix as-is; do not re-dedup | | Deduped a non-UMI bulk RNA-seq BAM | Coordinate dups are biological there | Do not dedup; report duplication as a diagnostic | | Molecule count too high | --method unique (no UMI error model) | Use directional (default) | | Aligner soft-clips/mismaps the UMI | Dedup attempted before extract, or UMI left in read | extract first; UMI must leave the aligned sequence | | Amplicon molecules under-counted | UMI too short -> collisions at shared coordinates | Use a longer UMI; size with AmpUMI | | Duplex yields few consensus reads | Many families missing one strand | Expected; duplex needs ~2x raw reads | | Consensus BAM still noisy | Skipped FilterConsensusReads | Always filter/mask after calling consensus |

References

Smith T, Heger A, Sudbery I. 2017. UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy. Genome Research 27(3):491-499. Liu D. 2019. Algorithms for efficiently collapsing reads with Unique Molecular Identifiers. PeerJ 7:e8275. Islam S, Zeisel A, Joost S, et al. 2014. Quantitative single-cell RNA-seq with unique molecular identifiers. Nature Methods 11(2):163-166. Schmitt MW, Kennedy SR, Salk JJ, et al. 2012. Detection of ultra-rare mutations by next-generation sequencing. PNAS 109(36):14508-14513. Kennedy SR, Schmitt MW, Fox EJ, et al. 2014. Detecting ultralow-frequency mutations by Duplex Sequencing. Nature Protocols 9(11):2586-2606. Clement K, Farouni R, Bauer DE, Pinello L. 2018. AmpUMI: design and analysis of unique molecular identifiers for deep amplicon sequencing. Bioinformatics 34(13):i202-i210.

Related Skills

read-qc/fastp-workflow - UMI extraction folded into preprocessing read-qc/rnaseq-qc - Why non-UMI bulk RNA-seq must NOT be deduplicated alignment-files/duplicate-handling - Coordinate dedup for non-UMI DNA single-cell/preprocessing - scRNA-seq UMI matrices and downstream liquid-biopsy/ctdna-mutation-detection - Duplex consensus for rare-variant detection

<!-- END FILE: read-qc/umi-processing/SKILL.md --> <!-- END CATEGORY: read-qc -->