Back to skills
extension
Category: Development & EngineeringNo API key required

bio-workflows-clip-pipeline

End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods.

personAuthor: jakexiaohubgithub

Version Compatibility

Reference examples tested with: umi_tools 1.1.5+, cutadapt 4.6+, fastp 0.23+, STAR 2.7.11b+, samtools 1.19+, bedtools 2.31+, CLIPper 2.0+, Skipper (commit 2023.05+), PureCLIP 1.3.1+, HOMER 4.11+, ChIPseeker 1.40+, preseq 3.2+, picard 3.1+, idr 2.0.4+, MultiQC 1.21+.

Before using code patterns, verify installed versions match. If versions differ:

  • CLI: <tool> --version then <tool> --help to confirm flags
  • Python: pip show <package> then help(module.function) to check signatures
  • R: packageVersion('<pkg>') then ?function_name to verify parameters

If code throws unexpected errors, introspect the installed tool and adapt the example rather than retrying.

CLIP-seq End-to-End Pipeline

"Analyze my CLIP-seq data from raw FASTQ to ENCODE-compliant binding sites" -> Orchestrate protocol-specific UMI extraction, 3'-only adapter trimming (preserving the R2 5' truncation = crosslink site -1), ENCODE STAR alignment, UMI-based deduplication, library complexity QC, peak calling against SMInput with stringent thresholds (log2 FC >= 3 AND -log10 p >= 3), single-nucleotide crosslink-site detection, ChIPseeker annotation with CLIP-appropriate tssRegion, motif discovery with GC-matched background and CL-position registration, and optional differential binding between conditions.

This is a workflow skill: it owns the chaining decisions and hand-offs, not the internals of any one step.

The governing principle

A CLIP callset is decided at four seams, not inside the peak caller.

  1. The protocol variant is the master commitment made once at the top. It fixes the UMI pattern, the STAR mismatch ceiling, and the crosslink signal (truncation vs PAR-CLIP T->C vs STAMP C->U edit). The CLIP Variant Selection table below is that decision; everything downstream inherits it.
  2. Every IP is normalized against its SMInput with ENCODE-stringent thresholds (log2 FC >= 3 AND -log10 p >= 3). Peaks called without SMInput normalization are enrichment-uncontrolled and dominated by abundance.
  3. The R2 5' end IS the crosslink site (-1), so preprocessing and alignment must PRESERVE it. Trim 3'-only and permissively (-q 6, never -g on R1), and align with STAR --alignEndsType EndToEnd - soft-clipping or aggressive 5' trimming destroys the truncation base and with it single-nucleotide resolution.
  4. 40-70% PCR duplication is BY DESIGN; low duplication signals a FAILED IP, not a clean library. The IP enriches a small molecule pool, so the real quality metric is the UNIQUE-fragment count after UMI dedup - never the raw duplication rate.

Pipeline Overview

FASTQ + SMInput
  -> [clip-preprocessing]    UMI extract + 3' adapter trim (-q 6 -m 18) + two-pass for eCLIP
  -> [clip-alignment]        STAR ENCODE block (alignEndsType EndToEnd, mismatch 0.04 or 0.07 for PAR-CLIP) + UMI dedup
  -> [clip-qc]               preseq, FRiP, IDR rescue + self-consistency, read distribution
  -> [clip-peak-calling]     CLIPper + SMInput log2 norm (stringent: log2 FC >= 3, -log10 p >= 3) OR Skipper (substantially more sites)
  -> [crosslink-site-detection] PureCLIP or CTK CITS for single-nt CL positions
  -> [binding-site-annotation] ChIPseeker (tssRegion=c(-100,100), level=transcript) + RBP-Maps for splicing factors
  -> [clip-motif-analysis]   HOMER + mCross (registered) + RBNS Kd cross-check
  -> [differential-clip]     DEWSeq window-level NB with type:condition interaction (optional)

CLIP Variant Selection

| Variant | When to use | UMI pattern | STAR mismatch ceiling | Detection signal | |---------|-------------|-------------|----------------------|------------------| | eCLIP (Van Nostrand 2016) | ENCODE comparability; SMInput available | 10 nt R1 | 0.04 | R2 5' truncation | | iCLIP / iCLIP2 / iCLIP3 | Single-end; high motif specificity | NNNXXXXNN (3+4+2; demux first) | 0.04 | R1 5' truncation | | irCLIP / FLASH | Non-radioactive; fast | Protocol-specific | 0.04 | Truncation | | PAR-CLIP | Photoactivatable nucleoside (4SU); HEK293/K562 | 4 nt typical | 0.07 (raised for T->C) | T->C transitions | | miCLIP / miCLIP2 | m6A modification | iCLIP-style | 0.04 | Truncation + C->T at m6A | | STAMP / scSTAMP | Antibody-free; in vivo or single-cell | NA (no UV) | 0.04 (RNA-seq mode) | C->U editing (RBP-APOBEC1 fusion) | | chimeric eCLIP / miR-eCLIP | Direct miRNA-target pairs | 10 nt R1 | 0.04 | Chimeric reads |

Step 1: Quality Control of Raw FASTQ

# Initial QC
fastqc raw_R1.fq.gz raw_R2.fq.gz -o qc/raw/

# Inspect first 12 bases of 100 reads to verify UMI pattern matches the prep
zcat raw_R1.fq.gz | awk 'NR%4==2' | head -100 | cut -c1-12 | sort | uniq -c | sort -rn | head
# Random barcode positions show ~25% per base; library barcodes are fixed

Step 2: Preprocessing (Protocol-Specific)

Goal: Convert raw CLIP FASTQ into UMI-deduplicated, alignment-ready FASTQ while preserving the R2 5' end (= crosslink site -1) that drives single-nucleotide resolution downstream.

Approach: Use the protocol-matched UMI pattern (10 nt eCLIP, NNNXXXXNN iCLIP, 4 nt PAR-CLIP), run umi_tools extract to move random barcodes to read names, then apply cutadapt with 3'-only adapter trimming at -q 6 -m 18 (permissive 5' to protect the truncation base). eCLIP uses two-pass trimming to remove read-through inline adapters from R2 5' only; iCLIP and PAR-CLIP use single-pass.

# eCLIP: 10 nt UMI on R1; two-pass adapter trim for read-through
# See clip-seq/clip-preprocessing for protocol-specific patterns
umi_tools extract \
    --bc-pattern=NNNNNNNNNN \
    --stdin=raw_R1.fq.gz --read2-in=raw_R2.fq.gz \
    --stdout=R1.umi.fq.gz --read2-out=R2.umi.fq.gz \
    --log=qc/umi_extract.log

# Pass 1: 3' adapter on both reads
# -q 6 is intentionally permissive; aggressive trimming destroys R2 5' = CL site -1
cutadapt \
    -a AGATCGGAAGAGCACACGTCT \
    -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
    --quality-base 33 -q 6 -m 18 \
    -j 8 \
    -o R1.p1.fq.gz -p R2.p1.fq.gz \
    R1.umi.fq.gz R2.umi.fq.gz \
    > qc/cutadapt_pass1.log 2>&1

# Pass 2: strip read-through 5' adapter from R2 only (NEVER -g on R1)
cutadapt \
    -G GATCGTCGGACTGTAGAACTCTGAAC \
    --quality-base 33 -q 6 -m 18 \
    -j 8 \
    -o R1.trim.fq.gz -p R2.trim.fq.gz \
    R1.p1.fq.gz R2.p1.fq.gz \
    >> qc/cutadapt_pass2.log 2>&1

For PAR-CLIP: same UMI extraction but downstream alignment raises --outFilterMismatchNoverReadLmax from 0.04 to 0.07 (the T->C signature would otherwise be filtered as sequencing error). See clip-seq/clip-preprocessing for full per-protocol guidance.

Step 3: Alignment (ENCODE STAR Block)

# ENCODE eCLIP convention. Sacred: --alignEndsType EndToEnd (soft-clip would destroy truncation = CL site -1)
STAR --runMode alignReads \
    --runThreadN 16 \
    --genomeDir /path/to/STAR_hg38_index \
    --genomeLoad NoSharedMemory \
    --readFilesIn R1.trim.fq.gz R2.trim.fq.gz \
    --readFilesCommand zcat \
    --outFilterType BySJout \
    --outFilterMultimapNmax 1 \
    --alignEndsType EndToEnd \
    --outFilterMismatchNoverReadLmax 0.04 \
    --outFilterScoreMinOverLread 0.66 \
    --outFilterMatchNminOverLread 0.66 \
    --outSAMtype BAM SortedByCoordinate \
    --outSAMattributes All \
    --outFileNamePrefix sample_

samtools index sample_Aligned.sortedByCoord.out.bam

# MAPQ >= 10 (255 = unique in STAR; lower = multi-mapper)
samtools view -b -q 10 sample_Aligned.sortedByCoord.out.bam > sample_q10.bam
samtools index sample_q10.bam

# UMI dedup. ENCODE convention: --method=unique
umi_tools dedup \
    --stdin=sample_q10.bam \
    --stdout=sample_dedup.bam \
    --method=unique \
    --paired \
    --log=qc/dedup.log
samtools index sample_dedup.bam

For PAR-CLIP: change --outFilterMismatchNoverReadLmax 0.04 to 0.07. For repeat-binding RBPs (MATR3, ZFP36, FUS at LINE-1, HNRNPK at SINEs): change --outFilterMultimapNmax 1 to 100 and add --outSAMmultNmax -1, then run CLAM downstream for EM-based multi-mapper assignment. See clip-seq/clip-alignment for full guidance.

Step 4: QC (Five Gates)

# Gate 1: preprocessing retention (cutadapt log, target >= 70%)
grep -E "passing filters|Pairs written" qc/cutadapt_pass1.log

# Gate 2: alignment rate (STAR Log.final.out, target >= 60% eCLIP, 70% iCLIP)
grep "Uniquely mapped reads %" sample_Log.final.out

# Gate 3: library complexity (preseq, target >= 1M unique at sequenced depth)
preseq lc_extrap -B -P sample_q10.bam -o qc/preseq.txt

# Gate 4: FRiP (after peak calling; target >= 0.005 narrow-binding RBP)
# Gate 5: IDR replicate reproducibility (after peak calling; target rescue and self-consistency < 2)

# Aggregate all QC into a single MultiQC report
multiqc qc/ -o qc/multiqc/

CLIP libraries have 40-70% PCR duplication BY DESIGN (the IP enriches a small molecule pool). Low duplication usually means failed IP, not a good library. The unique-fragment count after UMI dedup is the actual quality metric. See clip-seq/clip-qc for full five-gate diagnostic.

Step 5: Peak Calling

# CLIPper (ENCODE canonical) + SMInput log2 normalization
clipper \
    -b sample_dedup.bam \
    -s GRCh38 \
    -o peaks/sample.clipper.bed \
    --FDR 0.05 \
    --save-pickle \
    --processors 8   # super-local p-values are hard-coded ON in current CLIPper; the --superlocal flag was removed

# ENCODE stringent: log2(IP/SMInput) >= 3 AND -log10 p >= 3
# (Yeo lab eclip-pipeline scripts implement the normalization; see clip-seq/clip-peak-calling)
python overlap_peakfi_with_bam_PE.py \
    peaks/sample.clipper.bed \
    sample_dedup.bam sminput_dedup.bam \
    sample_dedup.bam.readnum.txt sminput_dedup.bam.readnum.txt \
    peaks/sample.normed.bed

python compress_l2foldenrpeakfi_for_replicate_overlapping_bedformat.py \
    peaks/sample.normed.bed \
    peaks/sample.compressed.bed

# Stringent filter
awk 'BEGIN{FS=OFS="\t"} $5 >= 3 && $6 >= 3' peaks/sample.compressed.bed > peaks/sample.stringent.bed

For maximum sensitivity (substantially more sites than CLIPper for mRNA-binding RBPs), use the Skipper Snakemake workflow with the same SMInput control. Mandatory for FASTKD2 / mt-RBPs which CLIPper misses on chrM. See clip-seq/clip-peak-calling for the full caller taxonomy.

Step 6: Single-Nucleotide Crosslink-Site Detection

# PureCLIP: HMM jointly modeling enrichment + truncation + CL motif.
# -iv learns HMM parameters on a CHROMOSOME SUBSET (semicolon-delimited) to cut memory/runtime
# (per PureCLIP docs); it is NOT a BED. To limit the callset to expressed regions, pre-filter the input BAM.
pureclip \
    -i sample_dedup.bam -bai sample_dedup.bam.bai \
    -g genome.fa \
    -ibam sminput_dedup.bam -ibai sminput_dedup.bam.bai \
    -o crosslinks/sample.sites.bed \
    -or crosslinks/sample.regions.bed \
    -nt 8 -dm 8 \
    -iv 'chr1;chr2;chr3;'

Single-nt CL sites feed mCross motif registration and allele-specific binding analyses. They are NOT a replacement for the broad peak list; complementary outputs. See clip-seq/crosslink-site-detection.

Step 7: IDR Across Replicates

# Sort each replicate's compressed BED by signal (log2 FC, column 5)
sort -k5,5gr peaks/rep1.compressed.bed > peaks/rep1.sorted.bed
sort -k5,5gr peaks/rep2.compressed.bed > peaks/rep2.sorted.bed

# True replicates threshold 0.05
idr --samples peaks/rep1.sorted.bed peaks/rep2.sorted.bed \
    --input-file-type bed --rank 5 \
    --output-file qc/idr.true.out \
    --idr-threshold 0.05 \
    --plot --log-output-file qc/idr.log

# ENCODE rule: rescue + self-consistency ratios both < 2 to pass
# Pseudo-replicate IDR (split BAM in half) at threshold 0.10

Step 8: Binding-Site Annotation

# CLIP-appropriate ChIPseeker (tssRegion tight; level=transcript)
library(ChIPseeker)
library(TxDb.Hsapiens.UCSC.hg38.knownGene)
txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene

peaks <- readPeakFile('peaks/sample.stringent.bed')
anno <- annotatePeak(
    peaks,
    TxDb = txdb,
    level = 'transcript',
    tssRegion = c(-100, 100),
    genomicAnnotationPriority = c('Promoter','5UTR','3UTR','Exon','Intron','Downstream','Intergenic')
)
plotAnnoPie(anno)

Default ChIPseeker tssRegion=c(-3000, 3000) over-extends for CLIP (would label 30-50% peaks as "Promoter"). Splicing factors additionally need RBP-Maps (Yeo lab) for the 1400 nt cassette-exon regulatory metagene. See clip-seq/binding-site-annotation.

Step 9: Motif Analysis (De Novo + CL-Registered)

# Extract peak sequences (strand-preserving)
bedtools getfasta -fi genome.fa -bed peaks/sample.stringent.bed -s -fo motifs/peaks.fa

# GC-matched 3' UTR background (NOT auto-shuffled, which biases to AU)
bedtools shuffle -i peaks/sample.stringent.bed -g chrom.sizes \
    -incl expressed_3utr.bed -seed 42 > motifs/background.bed
bedtools getfasta -fi genome.fa -bed motifs/background.bed -s -fo motifs/background.fa

# HOMER de novo
findMotifs.pl motifs/peaks.fa fasta motifs/homer \
    -rna -len 5,6,7,8 -p 8 -fasta motifs/background.fa

# mCross for CL-position-registered motif. mCross.pl takes a POSITIONAL FASTA of sequences
# pre-extracted/registered around the CL sites and an output stem (not a BED + genome + -i/-g/-k/-o):
#   bedtools slop -i crosslinks/sample.sites.bed -g genome.sizes -b 10 | bedtools getfasta -fi genome.fa -bed - -s > motifs/peakseqs.fa
mCross.pl motifs/peakseqs.fa motifs/mcross   # see clip-seq/clip-motif-analysis for options

UV254 crosslinking has a strong U bias at CL sites; naive logos centered on CL positions are U-enriched even for non-U-binding RBPs. mCross corrects this by registering motif relative to the CL offset. See clip-seq/clip-motif-analysis.

Step 10: Differential Binding (Optional, Across Conditions)

# DEWSeq window-level NB with the interaction-term design
# The interaction `~ type + condition + type:condition` tests whether IP/SMInput ratio shifts;
# naive `~ condition` confounds binding with expression changes.
library(DEWSeq)
counts <- read.table('counts/merged.tsv', sep='\t', header=TRUE, row.names=1)
colData <- data.frame(
    type = relevel(factor(c('ip','ip','ip','ip','sminput','sminput','sminput','sminput')), ref='sminput'),
    condition = relevel(factor(c('treat','treat','ctrl','ctrl','treat','treat','ctrl','ctrl')), ref='ctrl')
)
dds <- DESeqDataSetFromSlidingWindows(
    countData=counts, colData=colData,
    annotObj='annotation.txt',   # htseq-clip TAB annotation table (named columns), NOT a plain BED
    design = ~ type + condition + type:condition
)
dds <- DESeq(dds)
# with sminput/ctrl as the references, the interaction coefficient is typeip.conditiontreat
res <- results(dds, name='typeip.conditiontreat')

See clip-seq/differential-clip for full DEWSeq workflow and the htseq-clip preprocessing required upstream.

Quality Checkpoints

| Step | Metric | ENCODE target | |------|--------|---------------| | Preprocessing | Retention after adapter trim | >= 70% | | Alignment | Unique mapping rate | >= 60% (eCLIP); >= 70% (iCLIP) | | Complexity | preseq predicted unique at 100M reads | >= 10M (good); >= 1M (minimum acceptable) | | Peak calling | FRiP (narrow-binding RBP) | >= 0.005 | | Peak calling | Stringent peaks log2(IP/SMI) | >= 3 | | Peak calling | Stringent peaks -log10 p | >= 3 | | IDR | Rescue ratio | < 2 | | IDR | Self-consistency ratio | < 2 | | Annotation | Top RBP-class match expectation | Y (HuR -> 3' UTR; PTBP1 -> intron; FASTKD2 -> chrM) |

Per-Variant Adjustments

  • PAR-CLIP: Raise STAR --outFilterMismatchNoverReadLmax from 0.04 to 0.07; downstream use PARalyzer or CTK CIMS substitution T->C
  • iCLIP / iCLIP2 multiplexed: Demultiplex by inline library barcode (NNNXXXXNN) BEFORE umi_tools extract
  • HITS-CLIP: Use deletion-tolerant aligner (BWA-aln); downstream CTK CIMS deletion mode
  • Repeat-binding RBPs: STAR --outFilterMultimapNmax 100 --outSAMmultNmax -1 + CLAM EM rescue
  • m6A profiling: Switch to clip-seq/m6a-clip (miCLIP2 + m6Aboost or GLORI)
  • Antibody unavailable: Switch to clip-seq/stamp-antibody-free (STAMP or TRIBE)
  • miRNA targets: Switch to clip-seq/ago-clip-mirna-targets (chimeric eCLIP / miR-eCLIP)
  • Variant-effect prediction: Use clip-seq/clip-deep-learning (RBPNet or RNAProt)

Common Errors

| Symptom | Cause | Fix | |---------|-------|-----| | Peaks everywhere, dominated by abundant transcripts | No SMInput normalization | Normalize IP against SMInput; keep log2 FC >= 3 AND -log10 p >= 3 | | Single-nucleotide resolution lost | Soft-clipping or aggressive 5' trim destroyed the R2 truncation base | STAR --alignEndsType EndToEnd; 3'-only -q 6 trim; never -g on R1 | | PAR-CLIP T->C signal missing | Mismatch ceiling 0.04 filtered the transitions as error | Raise --outFilterMismatchNoverReadLmax to 0.07 | | "Low-complexity" library discarded | Judged on raw duplication (40-70% is normal for CLIP) | Use the unique-fragment count after UMI dedup as the quality metric | | Motif logo is all-U even for a non-U-binding RBP | Naive CL-centered logo + UV U-bias | mCross CL-registered motif + GC-matched (not shuffled) background | | 30-50% of peaks labeled "Promoter" | Default tssRegion=c(-3000,3000) over-extends for CLIP | Tight tssRegion=c(-100,100), level='transcript' | | Differential binding confounded with expression | ~ condition design | ~ type + condition + type:condition interaction (DEWSeq) |

References

  • Van Nostrand EL, Pratt GA, Shishkin AA, et al (2016) Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods 13:508-514. DOI 10.1038/nmeth.3810.
  • Van Nostrand EL, Freese P, Pratt GA, et al (2020) A large-scale binding and functional map of human RNA-binding proteins. Nature 583:711-719. DOI 10.1038/s41586-020-2077-3. (ENCODE RBP; SMInput + IDR practice.)
  • Krakau S, Richard H, Marsico A (2017) PureCLIP: capturing target-specific protein-RNA interaction footprints from single-nucleotide CLIP-seq data. Genome Biology 18:240. DOI 10.1186/s13059-017-1364-2.
  • Li Q, Brown JB, Huang H, Bickel PJ (2011) Measuring reproducibility of high-throughput experiments. Annals of Applied Statistics 5:1752-1779. DOI 10.1214/11-AOAS466. (IDR.)

Related Skills

  • clip-seq/clip-preprocessing - UMI extraction and adapter trimming details
  • clip-seq/clip-alignment - STAR ENCODE block + multi-mapper rescue
  • clip-seq/clip-qc - Five-gate QC framework
  • clip-seq/clip-peak-calling - CLIPper / Skipper / PureCLIP / CTK taxonomy
  • clip-seq/crosslink-site-detection - Single-nt CL detection by chemistry
  • clip-seq/binding-site-annotation - ChIPseeker + RBP-Maps
  • clip-seq/clip-motif-analysis - HOMER + mCross + RBNS validation
  • clip-seq/differential-clip - DEWSeq + Flipper for cross-condition
  • clip-seq/m6a-clip - miCLIP2 / GLORI / DART for m6A modifications
  • clip-seq/stamp-antibody-free - STAMP / TRIBE for antibody-free profiling
  • clip-seq/ago-clip-mirna-targets - chimeric eCLIP for direct miRNA-target pairs
  • clip-seq/clip-deep-learning - RBPNet / RNAProt for variant-effect prediction
  • read-qc/quality-reports - FastQC / MultiQC upstream QC
  • reporting/automated-qc-reports - MultiQC aggregates the per-tool QC into one report; gating stays in the five-gate framework, not MultiQC
  • alternative-splicing/differential-splicing - Cassette exon tables for RBP-Maps