Back to skills
extension
Category: Development & EngineeringNo API key required

bio-transcription-translation

Transcribe DNA to RNA and translate to protein using Biopython. Use when converting between DNA, RNA, and protein sequences, finding ORFs, or using alternative codon tables.

personAuthor: jakexiaohubgithub

Version Compatibility

Reference examples tested with: BioPython 1.83+

Before using code patterns, verify installed versions match. If versions differ:

  • Python: pip show <package> then help(module.function) to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Transcription and Translation

"Translate my DNA sequence to protein" -> Transcribe DNA to RNA and translate to protein, choosing the right genetic code and validating the reading frame.

  • Python: Seq.translate(), Seq.transcribe(), Bio.Data.CodonTable (BioPython)

The Governing Principle

The single most dangerous bug in translation is silent: a valid-but-wrong table= argument produces a plausible wrong protein with no error. Translating human mitochondrial DNA with the default Standard code (table 1) inserts * where UGA actually codes Trp and truncates at AGA/AGG (which are stops in vertebrate mito). The protein looks real and nothing complains. By contrast, an unknown table id or name raises KeyError (loud). Only valid-but-wrong tables corrupt silently.

The defense: when the input is a complete coding sequence, pass cds=True. It converts silent traps into loud TranslationError exceptions by validating start, length, and stop. Use it for ORF validation rather than trusting a clean-looking output.

Since the Biopython 1.78 alphabet removal, transcribe(), back_transcribe(), and translate() perform NO type checking. Transcribing a protein or translating the wrong strand returns silent garbage. Confirm the molecule and strand before converting.

Required Import

from Bio.Seq import Seq
from Bio.Data import CodonTable

Transcription Is a String Operation, Not Biology

transcribe() is a pure T->U replacement on the coding (sense) strand; back_transcribe() is U->T. Neither performs splicing, intron removal, 5' capping, or poly-A addition. The Biopython tutorial states plainly that all transcribe does is replace T with U.

coding_dna = Seq('ATGCGATCGATCG')
rna = coding_dna.transcribe()        # Seq('AUGCGAUCGAUCG'), T->U only
back = rna.back_transcribe()         # Seq('ATGCGATCGATCG'), U->T only

True biological transcription starts from the template strand, so reverse-complement first:

template = Seq('CGATCGATCGCAT')
mrna = template.reverse_complement().transcribe()

Translation accepts DNA or RNA directly, so explicit transcription is rarely needed before translate().

Translation Basics

coding_dna = Seq('ATGTTTGGT')
coding_dna.translate()               # Seq('MFG'), from DNA
Seq('AUGUUUGGU').translate()         # Seq('MFG'), from RNA

Stop-Codon Behavior

translate() substitutes stop_symbol (default '*') for EVERY in-frame stop, so internal stops appear as * mid-protein. to_stop=True instead halts at the first in-frame stop and does NOT append the symbol.

seq = Seq('ATGTTTGGTTAAGGG')
seq.translate()                      # Seq('MFG*G'), stop shown, translation continues
seq.translate(to_stop=True)          # Seq('MFG'), halts at first stop

NCBI Codon Tables: Which Code, and the Consequence of the Wrong One

Biopython exposes every NCBI genetic code by integer id or registered name. Selecting the wrong one is the #1 silent bug (see governing principle).

| ID | Name | Key reassignments vs Standard | When it matters | |----|------|-------------------------------|-----------------| | 1 | Standard | none (baseline) | Most nuclear genes | | 2 | Vertebrate Mitochondrial | AGA/AGG -> STOP; AUA -> Met; UGA -> Trp | Human/vertebrate mtDNA (4 stops: UAA, UAG, AGA, AGG) | | 3 | Yeast Mitochondrial | CUN (all four CU*) -> Thr; AUA -> Met; UGA -> Trp | CTG -> Thr lives HERE, not table 12 | | 4 | Mold/Protozoan Mito + Mycoplasma/Spiroplasma | UGA -> Trp (only change) | Fungal/protozoan mito; Mycoplasma | | 5 | Invertebrate Mitochondrial | AGA/AGG -> Ser; AUA -> Met; UGA -> Trp | Insect/worm mito (AGA/AGG=Ser, not STOP as in table 2) | | 6 | Ciliate Nuclear | UAA/UAG -> Gln; only UGA stays stop | Tetrahymena, Paramecium (single stop) | | 11 | Bacterial/Archaeal/Plastid | same coding as Standard; expanded starts | Prokaryotes, plastids (differs from 1 mainly in initiation) | | 12 | Alternative Yeast Nuclear | CUG -> Ser (from Leu) | Candida CUG-Ser clade |

Explicit correction: CTG -> Thr is table 3 (Yeast Mitochondrial). Table 12 is CUG -> Ser. Do not conflate them.

seq = Seq('ATGGCCTGA')
seq.translate(table=2)                            # by NCBI integer id
seq.translate(table='Vertebrate Mitochondrial')   # by registered name

CodonTable.unambiguous_dna_by_id[2]
CodonTable.unambiguous_dna_by_name['Vertebrate Mitochondrial']

Validating a Coding Sequence with cds=True

Goal: Translate a complete ORF and have any structural defect raise a loud error instead of producing a silent wrong protein.

Approach: Pass cds=True. It enforces four conditions, each raising Bio.Data.CodonTable.TranslationError on failure: (1) first codon is a start codon for the chosen table; (2) length is a multiple of 3; (3) sequence ends in a stop; (4) no internal in-frame stop. A valid alternative start (GTG/TTG/ATT) is translated as M, biologically correct for fMet initiation. The terminal stop is stripped from the output.

Reference (BioPython 1.83+):

cds = Seq('ATGTTTGGTTAA')
cds.translate(cds=True)              # Seq('MFG'), validated, terminal stop removed

alt_start = Seq('GTGTTTGGTTAA')
alt_start.translate(table=11, cds=True)   # Seq('MFG'), GTG start -> M under bacterial code

Start-codon lists differ by table: table 1 = TTG/CTG/ATG; table 2 = ATT/ATC/ATA/ATG/GTG; table 11 = TTG/CTG/ATT/ATC/ATA/ATG/GTG. A start valid under one table fails under another, which is exactly the loud signal cds=True provides.

translate() Parameters and Edge Cases

Signature (the Seq.translate METHOD): translate(table='Standard', stop_symbol='*', to_stop=False, cds=False, gap='-'). The Seq method defaults to gap='-', while both the module-level Bio.Seq.translate(sequence, ...) function and SeqRecord.translate() default to gap=None.

  • Partial codon (length not a multiple of 3): emits a BiopythonWarning and SILENTLY drops the trailing 1-2 bases. Easy to miss in a pipeline. Under cds=True the same condition becomes a loud TranslationError.
  • Gaps: because the Seq method defaults to gap='-', a full gap codon '---' already translates to '-' (e.g. Seq('GTG---GCCATT').translate() -> 'V-AI', no error). A codon mixing gaps and bases ('TT-') raises TranslationError. SeqRecord.translate() instead defaults to gap=None, so even a full '---' codon raises unless gap='-' is passed; mixed gap/base codons still raise. For alignment-derived CDS, preserve codon and alignment semantics with alignment/multiple-alignment or the project's established translation wrapper rather than assuming one gap-normalization policy.
  • Dual-coding stop tables (27 Karyorelict, 28 Condylostoma, 31 Blastocrithidia Nuclear): these reassign a stop codon so it codes both an amino acid and stop, so to_stop=True raises a ValueError (no single truncation point).
Seq('ATGTTTGG').translate()          # BiopythonWarning, trailing 'GG' dropped -> Seq('MF')
Seq('ATGTTTGG').translate(cds=True)  # TranslationError: length not a multiple of three

Selenocysteine and Pyrrolysine Are Silently Lost

Selenocysteine (Sec, one-letter U) is encoded by UGA and pyrrolysine (Pyl, one-letter O) by UAG, both normally stop codons. Recoding requires a SECIS (Sec) or PYLIS (Pyl) element that Biopython does NOT detect. No NCBI table maps UGA->U or UAG->O. Naive translation therefore yields * mid-protein, and to_stop=True SILENTLY truncates the protein at that position. Real selenoproteins (GPX, TXNRD, SELENOP) come out truncated or peppered with *. There is no clean Biopython workaround; flag these genes and handle the recoding event manually.

Six-Frame Translation

Goal: Translate a DNA sequence in all six frames (three forward, three reverse) to expose every possible protein product.

Approach: For each strand, offset by 0, 1, 2 bases, trim to a multiple of 3, and translate.

Reference (BioPython 1.83+):

def six_frame_translation(seq):
    frames = []
    for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
        for frame in range(3):
            length = 3 * ((len(s) - frame) // 3)
            fragment = s[frame:frame + length]
            frames.append((strand, frame, fragment.translate()))
    return frames

seq = Seq('ATGCGATCGATCGATCGATCG')
for strand, frame, protein in six_frame_translation(seq):
    print(f'{strand}{frame}: {protein}')

Find All ORFs (Start to Stop)

Goal: Identify all open reading frames (Met to stop) across both strands and all three frames, keeping only those above a minimum length.

Approach: Translate each of the six frames, then scan each translation for Met-to-stop segments meeting the threshold.

Reference (BioPython 1.83+):

def find_orfs(seq, min_protein_length=30):
    orfs = []
    for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
        for frame in range(3):
            end = frame + 3 * ((len(s) - frame) // 3)
            trans = str(s[frame:end].translate())
            aa_start = 0
            while True:
                start = trans.find('M', aa_start)
                if start == -1:
                    break
                stop = trans.find('*', start)
                if stop == -1:
                    stop = len(trans)
                orf = trans[start:stop]
                if len(orf) >= min_protein_length:
                    orfs.append((strand, frame, start * 3 + frame, orf))
                aa_start = start + 1
    return orfs

seq = Seq('ATGCGATCGATCGATCGATCGTAA')
for strand, frame, pos, orf in find_orfs(seq, min_protein_length=3):
    print(f'{strand} frame {frame} pos {pos}: {orf}')

Inspect a Codon Table

table = CodonTable.unambiguous_dna_by_id[2]
table.start_codons                   # ['ATT', 'ATC', 'ATA', 'ATG', 'GTG']
table.stop_codons                    # ['TAA', 'TAG', 'AGA', 'AGG']
table.forward_table['TGA']           # 'W' under vertebrate mito code

Common Errors

| Symptom | Cause | Fix | |---------|-------|-----| | Plausible protein, wrong residues, no error | Valid-but-wrong table= (e.g. mito DNA on table 1) | Select the organism's NCBI table; use cds=True to validate | | * mid-protein or premature truncation | Selenoprotein/pyrrolysine UGA/UAG, or wrong table where UGA=Trp | Use correct mito table for UGA=Trp; Sec/Pyl recoding is not automatic | | TranslationError: First codon ... is not a start codon | cds=True on a sequence not starting at a valid start for that table | Trim to the true start, or pick the table whose starts include it | | TranslationError: ... is not a multiple of three | cds=True on a partial CDS | Trim to a full ORF; without cds=True this only warns and drops trailing bases | | TranslationError: Extra in frame stop codon found | Internal stop under cds=True | Wrong frame, wrong table, or genuine internal stop; re-check frame/table | | Garbage protein from a protein input | transcribe()/translate() on a non-nucleotide Seq (no type checks since 1.78) | Verify molecule type before converting | | KeyError | Unknown table id or name | Use a valid NCBI id (1-6, 9-16, 21-31) or registered name |

Decision Tree

Need to convert a sequence?
├── DNA <-> RNA (string-level T<->U)?
│   ├── coding strand to RNA -> seq.transcribe()
│   ├── RNA back to DNA      -> seq.back_transcribe()
│   └── template strand to mRNA -> seq.reverse_complement().transcribe()
├── DNA/RNA to protein?
│   ├── alignment-derived CDS    -> alignment/multiple-alignment (codon-aware), or project wrapper
│   ├── complete CDS to validate -> translate(cds=True) [loud on defects]
│   ├── stop at first stop only  -> translate(to_stop=True)
│   ├── non-standard organism    -> translate(table=N)  [pick from the table above]
│   └── show internal stops      -> translate()  [* per stop]
└── Unknown coding regions? -> six-frame translation, then scan M...* for ORFs

Related Skills

  • seq-objects - Create and inspect Seq objects before translation
  • reverse-complement - Strand handling for six-frame translation and template-strand transcription
  • codon-usage - Analyze codon bias and adaptation in coding sequences
  • sequence-io/read-sequences - Parse GenBank/FASTA records and CDS features for translation

References

The genetic-code tables and their organism assignments follow the NCBI Taxonomy "The Genetic Codes" page, compiled by Andrzej (Anjay) Elzanowski and Jim Ostell at NCBI (https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi). This is a maintained web resource; cite it as the NCBI page rather than as a journal article.